Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Itoh, Y.
Right arrow Articles by Mizuno, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itoh, Y.
Right arrow Articles by Mizuno, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

The Journal of Heredity 2001:92(4)
© 2001 The American Genetic Association 92:315-321

Identification of the Sex of a Wide Range of Carinatae Birds by PCR Using Primer Sets Selected from Chicken EE0.6 and Its Related Sequences

Y. Itoh, M. Suzuki, A. Ogawa, I. Munechika, K. Murata, and S. Mizuno

From the Laboratory of Molecular Biology, Department of Molecular and Cell Biology, Graduate School of Agricultural Science, Tohoku University, 1-Tsutsumidori-Amamiyamachi, Aoba-ku, Sendai, Japan (Itoh, Suzuki, Ogawa, and Mizuno), Chiba Zoological Park, Wakaba-ku, Chiba, Japan (Munechika), and Kobe Municipal Oji Zoo, Nada-ku, Kobe, Japan (Murata).

Address correspondence to Shigeki Mizuno, Department of Agricultural and Biological Chemistry, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-8510, Japan, or e-mail: s-mizuno{at}brs.nihon-u.ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A 0.6 kb EcoRI fragment (EE0.6), cloned from the W chromosome of chickens, is a nonrepetitive sequence and contains an exonlike sequence, ET15, which is likely a part of a pseudogene. The EE0.6 sequence is conserved in all species of birds examined both in Carinatae and Ratitae. A counterpart sequence of EE0.6 is present on the Z chromosome. The extent of diversity between the W- and Z-linked sequences are variable among species. The W- and Z-linked EE0.6 sequences, cloned from 12 different species, were compared and four forward and three reverse primers were selected to amplify parts of the EE0.6 sequence by polymerase chain reaction (PCR). By choosing a suitable combination of primers for EE0.6 and a set of primers for a Z/W-common sequence, as an internal control, the sex of 36 species belonging to 16 different orders of Carinatae could be determined clearly by PCR. The sex of two other species representing different orders could be determined by Southern blot hybridization using ET15 as a probe. For the two Ratitae species, emu and ostrich, EE0.6 sequences on W and Z chromosomes could not be distinguished either by PCR or Southern blotting.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It has been estimated that the genetic sex of about half of all avian species cannot be identified by the external appearance of adult individuals, and this percentage should be even greater for young birds (Griffiths et al. 1998). Identification of the sex of birds is fundamentally important not only for captive breeding of endangered species like the oriental white stork and the Japanese crested ibis, but also for basic research such as molecular ecology and developmental biology. Application of the polymerase chain reaction (PCR) to identification of genetic sexes of birds is ideal because it requires only a small sample, such as a drop of blood or a single plucked feather, for DNA extraction, minimizing trauma to individual birds. The constitution of sex chromosomes of birds is ZW for females and ZZ for males. Thus any DNA sequence that is present only on the W chromosome and is widely conserved among species would be a target of PCR-based sex identification.

The XhoI and EcoRI family repetitive sequences on the chicken W chromosome are useful targets of PCR-based sex identification of chickens, particularly of early embryos (Nakabayashi et al. 1998), because these sequences are highly specific to the W chromosome (Kodama et al. 1987; Saitoh et al. 1991) and are clearly identifiable after a relatively small number of reaction cycles in PCR (Clinton 1994). However, the presence of these repetitive sequences on the W chromosome is limited to the genus Gallus (Mizuno and Macgregor 1998), and thus the procedure is not widely applicable among different avian species. Although the number of well-characterized genes and unique sequences on the avian W chromosome is limited, CHD-W (chromo-helicase-DNA binding protein gene) found on the chicken W chromosome (Ellegren 1996; Griffiths et al. 1998) and a unique sequence EE0.6 (0.6 kb EcoRI fragment) found on the long arm of the chicken W chromosome (Ogawa et al. 1997) have been utilized for the purpose of sex identification. The latter sequence is widely conserved on the W chromosome, not only in Carinatae species but also in Ratitae species (Ogawa et al. 1998). However, both CHD and EE0.6 sequences have their counterpart sequences on the Z chromosome, such as CHD-Z (Griffiths and Korn 1997) and XH0.6RSM in the oriental white stork (Ciconia boyciana) (Itoh et al. 1997), and the similarity of W- and Z-linked sequences is variable among species, which causes occasional ambiguous results in the sex determination (Griffiths et al. 1998; Ogawa et al. 1997).

In the present study, EE0.6 sequences on W and Z chromosomes were cloned from eight different species of birds that belonged to six different orders. Based on these sequences and previously determined EE0.6 sequences of the chicken, the domestic duck, the rock dove (Ogawa et al. 1997), and the oriental white stork (Itoh et al. 1997), four forward and three reverse primer sequences were selected to amplify parts of the EE0.6 sequence by PCR. Here we evaluate suitable combinations of these primers and a set of primers to amplify a Z/W common sequence, as an internal control, for their ability to determine genetic sexes of 36 Carinatae species belonging to 16 different orders.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preparation of Genomic DNA
High molecular weight genomic DNA was prepared from nuclei of blood cells, derived from about 1 ml of heparinized blood sample, according to Ogawa et al. (1997). The method of rapid mini-preparation of DNA was also utilized for about 10 µl of the heparinized blood sample according to Gemmell and Akiyama (1996), which yielded about 20 µg of DNA. Tissue samples for DNA extraction were stored at -80°C in 70% ethanol. A tissue sample was ground in a mortar with a pestle in the presence of liquid nitrogen. The resultant tissue powder was suspended in phosphate-buffered saline (PBS) (10 mM Na2HPO4, 1.4 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4) containing 10 mM ethylenediaminetetraacetic acid (EDTA) and centrifuged at 300g for 10 min. The pellet was resuspended in PBS and centrifuged again. The pellet was suspended in 10 mM Tris-HCl (pH 8.0), 100 mM EDTA (pH 8.0) and incubated in the presence of 0.5% sodium dodecyl sulfate (SDS), 100 µg/ml proteinase K at 50°C overnight. The mixture was extracted successively with phenol saturated with TE [10 mM Tris–HCl (pH 8.0), 1 mM EDTA], 1:1 mixture of TE-saturated phenol and chloroform, and chloroform. The supernatant was dialyzed extensively against TE and then against 0.1x TE.

Southern Blot Hybridization and PCR
High molecular weight genomic DNA preparations from individual birds were digested with HindIII and separated by 0.8% agarose gel electrophoresis (10 µg DNA/ lane) in 1x TBE (89 mM Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.0) at 30 V, and stained with ethidium bromide. A part of the gel containing DNA fragments larger than approximately 1 kb was soaked in 0.25 N HCl for 10 min at room temperature, followed by soaking the whole gel in 0.4 N NaOH, 0.6 M NaCl, and DNA fragments in the gel were capillary transferred to a Hybond N+ membrane (Amersham) in the same solution for 12 h. The membrane was soaked in 0.5 M Tris–HCl (pH 7.5), 1 M NaCl, washed in 2x SSC, and dried at 80°C for 2 h. A putative exon sequence, ET15, from the chicken W chromosome was 32P-labeled by the random priming method as described (Ogawa et al. 1997). Hybridization with 32P-labeled ET15 was carried out in 6x SSPE (0.9 M NaCl, 60 mM NaH2PO4, 6 mM EDTA, pH 7.4) containing 1% SDS and 1% skim milk at 65°C for 12 h, followed by washing the membrane in 2x SSC, 0.1% SDS at 25°C for 10 min twice and at 65°C for 30 min twice, and autoradiography.

PCR was carried out in a 50 µl mixture containing 0.2 mM each of dNTP, 0.4 µmM each of primers, 10 ng genomic DNA, 1.75 units Taq polymerase (SIGMA), and one-tenth volume of 10x PCR buffer (SIGMA). Primer sets and cycle conditions are listed in Table 1. The PCR product in 8 µl of the reaction mixture was separated by 1.5% agarose gel electrophoresis in 1x TAE (10 mM Tris, 4 mM acetic acid, 0.5 mM EDTA) at 100 V, and stained with ethidium bromide.


View this table:
[in this window]
[in a new window]
 
Table 1.. The primer sequences and PCR conditions

 


View larger version (98K):
[in this window]
[in a new window]
 
Figure 1.. Selection of a set of primers, AWS03 (forward) and NRD4 (reverse), for PCR amplification of a part of W-linked EE0.6 sequence. Sequences of subregions of W- or Z-linked EE0.6 from 12 or 10 different Carinatae species are compared and a forward primer (A) and a reverse primer (B) were selected. Conserved nucleotides (white letters), different nucleotides (black letters), gaps for alignment (bars), and the selected primer sequences are indicated.

 


View larger version (84K):
[in this window]
[in a new window]
 
Figure 2.. Positions and sequences of forward and reverse primers used for PCR amplification of parts of the EE0.6 sequence. The adopted primer sequences are indicated along with W-linked EE0.6 sequence of chickens (Ogawa et al. 1997), W-linked EE0.6-related sequence (XH0.6) of the oriental white stork (Itoh et al. 1997), and EE0.6-related sequences of the ostrich and emu (Ogawa et al. 1998). Levels of sequence identity are shown at the end of each sequence. A putative exon ET15 in the chicken EE0.6 (Ogawa et al. 1997) and the starting position of a 43-bp insertion (TAAATAAATAGTAAATCAATAGTAAAACAAATAATCAATAGTA) found in three species (the red avadavat, common finch, and Java sparrow) of the order Passeriformes (filled triangle) are indicated. Identical nucleotides are shown as in Figure 1. Mixed nucleotides in primer sequences are abbreviated as follows: A or C (M), C or G (S), A or T (W), A or G (R).

 
Cloning and Sequencing of PCR-amplified DNA Fragments
PCR products were cloned with the use of pGEM-T Easy vector (Promega). Nucleotide sequences were determined using a Thermo sequenase fluorescent-labeled primer cycle sequencing kit (Amersham) with -21 M13 dye primer (Amersham) and M13 reverse dye primer (Applied Biosystems) and a 373A DNA Sequencer (PE Applied Biosystems). DNA sequences were analyzed with DNASIS version 3.0 (HITACHI Software Engineering).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Primer Sequences Selected for Wide-range Sex Identification of Carinatae Species
In order to select primer sequences applicable for PCR-based sex identification of a variety of avian species, sequences related to the chicken EE0.6 were amplified by PCR, cloned, and sequenced from eight different species of birds (the violet turaco, snowy owl, red-crowned crane, secretary bird, streaked shearwater, red avadavat, common finch, and Java sparrow). Some samples were male/female pairs and others were female. These sequences and previously determined sequences for the chicken, domestic duck, and rock dove (Ogawa et al. 1997) and the oriental white stork (Itoh et al. 1997) were aligned and sequences of a forward primer, AWS03, and a reverse primer, NRD4, were selected for amplification of a part of EE0.6-related sequences linked to the W chromosome in a variety of species (Figure 1). In addition to this set of primers, previously selected USP1 (forward) and USP3 (reverse) primers from the W-linked EE0.6 sequence of chickens (Ogawa et al. 1997), and AWS05 (forward) primer from the W-linked EE0.6-related sequence (XH0.6) of the oriental white stork (Itoh et al. 1997) were used in combination to amplify parts of W-linked EE0.6-related sequences of various species by PCR (Table 1). A set of primers, KM81F (forward) and KM81R (reverse), was chosen from the Z-linked EE0.6-related sequence (XH0.6RSM) of the oriental white stork (Itoh et al. 1997) (Table 1A) and used for amplification of an EE0.6-related sequence of emu (Ratitae). The positions of these primer sequences are shown along with the W-linked EE0.6 sequence of the chicken (Ogawa et al. 1997), W-linked EE0.6-related sequence (XH0.6) of the oriental white stork (Itoh et al. 1997), and EE0.6-related sequences of the ostrich and emu (Ogawa et al. 1998) (Figure 2).

Furthermore, three sets of primers—CPE15F (forward)/CPE15R (reverse), INT-F (forward)/INT-R (reverse), and SINT-F (forward)/SINT-R (reverse) (Table 1A)—were chosen from the sequences of spindlin genes found on the W and Z chromosomes of chickens (Itoh et al. 2001) to amplify Z/W common sequences. Expected lengths of PCR products are 252 bp with CPE15F/CPE15R, 246 bp with INT-F/INT-R, and 151 bp with SINT-F/SINT-R. The first two sets of primers are to amplify the same genomic region of spindlin, but the primer lengths are different (Table 1A), allowing the use of different annealing temperatures (Table 1B). The PCR product obtained by using one of these primer sets migrated to a different position from that of the W-linked EE0.6 sequence on agarose-gel electrophoresis and served as an internal control to show that the genomic DNA sample was amplifiable by PCR under the conditions applied.

Identification of the Sex of Carinatae Species by PCR
Combinations of the above primers for amplification of W-linked EE0.6 sequences or Z/W common sequences and conditions of PCR were studied in detail for genomic DNA samples of males or females from 36 species of birds belonging to 16 different orders of Carinatae, and six different conditions (A–F in Table 1B) were established. Results of PCR-based sex identification for a group of species with each one of the six conditions are shown in Figure 3. In most cases, a single female (W)-specific band and a single band of an internal control (Z/W common) were observed. In some cases, weaker extra bands were amplified with a set of primers for EE0.6, but their mobilities were distinguishable from those of W-specific and internal control bands. Entire results of these experiments are summarized in Table 2, which indicate that among 36 species, sexes of some species are identifiable with the use of a particular condition and those of other species are identifiable under two or more different conditions.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 3.. Identification of the sex of various Carinatae species by PCR. Genomic DNA preparations from male (M) or female (F) samples of species indicated were subjected to PCR under different conditions (A–F) as listed in Table 1B. PCR products were separated by agarose gel electrophoresis and stained with ethidium bromide. Approximate sizes of a female-specific band and a female/male common band (internal control) are indicated. In (B), female-specific bands of red avadavat, common finch, and Java sparrow, each belonging to the order Passeriformes, are a little larger than others because of the presence of a conserved 43-bp insertion (Figure 2) in each sequence.

 

View this table:
[in this window]
[in a new window]
 
Table 2.. Summary of sex identification by PCR

 


View larger version (31K):
[in this window]
[in a new window]
 
Figure 4.. Southern blot hybridization of HindIII-digested genomic DNAs from the male (M) or female (F) of the Chinese button quail and the Rothschild's starling with 32P-labeled ET15 sequence.

 


View larger version (40K):
[in this window]
[in a new window]
 
Figure 5.. W- and Z-linked EE0.6 sequences of Ratitae species are not distinguishable. (A) Southern blot hybridization of HindIII-digested genomic DNAs from the male (M) or female (F) of the ostrich and emu with 32P-labeled ET15 sequence. (B; left panel) PCR products from genomic DNAs of the male or female of the ostrich and emu produced under condition D of Table 1B. The upper band is a Z/W common spindlin gene sequence and the lower band is an EE0.6 sequence. (B; right panel) An EE0.6 sequence amplified by PCR from the genomic DNA of the male or female emu with the use of KM81F and KM81R primers (Table 1A and Figure 2).

 
Identification of the Sex by Southern Blot Hybridization
DNA samples from females of two species, the Chinese button quail belonging to the order Turniciformes and the Rothschild's starling belonging to the order Passeriformes, did not produce a W-specific PCR product under any of the six different conditions (A–F in Table 1B). For this reason we adopted Southern blot hybridization to identify the sex of these species. When HindIII-digested genomic DNAs of these two species were subjected to Southern blot hybridization with 32P-labeled ET15, a putative exon sequence in the chicken EE0.6 (Ogawa et al. 1997), as a probe, a female-specific band plus two male/female common bands were detected (Figure 4). The latter two bands were most likely derived from the Z chromosome because their intensity ratios were approximately 2 (male) to 1 (female).

Inability to Identify the Sex of Ratitae Species with EE0.6-Related Sequences
It has been shown that EE0.6-related sequences are located on the putative sex chromosome pair of the emu and the ostrich (Ogawa et al. 1998). Thus if EE0.6-related sequences on the W and Z chromosomes of these species are sufficiently diversified, it may be possible to identify their sexes by PCR or by Southern blot hybridization as applied to the Carinatae species. However, when genomic DNA preparations from the male and the female of the ostrich or the emu were digested with HindIII and subjected to Southern blot hybridization with 32P-labeled ET15, they each produced a single band of hybridization with the same electrophoretic mobility from both sexes (Figure 5A). When genomic DNA from male and female ostriches or emus was subjected to PCR under the six different conditions (A–F in Table 1B), only condition D produced an EE0.6-derived band of the same electrophoretic mobility from both male and female of the ostrich (Figure 5B, left panel, lower bands). Although a Z/W common band derived from the spindlin sequence was produced from both ostrich and emu (Figure 5B, left panel, upper bands), an EE0.6-related sequence was not amplified from the genomic DNA of male and female emus under these conditions (Figure 5B, left panel). An EE0.6-related sequence was amplified from the emu by PCR with the use of KM81F and KM81R primers (Table 1A and Figure 2), but electrophoretic mobilities of the bands produced from the male and the female were the same (Figure 5B, right panel). These results indicate that even pseudogene-like sequences of EE0.6 on Z and W chromosomes have not been diversified to the extent recognizable with the above two methods during the course of evolution of the two Ratitae species.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is desirable for the sex identification of birds if one could find and utilize as a probe an evolutionarily conserved nonrepetitive sequence that is present only on the female-specific W chromosome. However, no such sequence has yet been detected. Genes found on the chicken W chromosome—CHD (chromo-helicase-DNA binding protein; Ellegren 1996; Ellegren and Fridolfsson 1997; Griffiths and Korn 1997), ATP5A1 (ATP synthase {alpha}-subunit; Fridolfsson et al. 1998), ASW/Wpkci (avian sex-linked gene on W/W-linked gene for the altered form of protein kinase C-interacting protein; Hori et al. 2000; O'Neill et al. 2000), and spindlin (Itoh et al. 2001)—have their counterpart genes on the Z chromosome.

The EE0.6 sequence seems to have certain advantages as a target for sex identification because the sequence is conserved widely in Carinatae and Ratitae species (Ogawa et al. 1998) and significant sequence divergence between W- and Z-linked sequences is expected to be found, because these sequences seem to have no genetic function. The putative exon, ET15, in the EE0.6 sequence of chickens was cloned with the use of the exon-trapping procedure, but each one of its reading frames contained at least one stop codon (Ogawa et al. 1997) and we have not found any related gene sequences in the EMBL/GenBank/DDBJ nucleotide sequence databases. Our previous studies with a limited number of species suggested that although the PCR-based identification of the W-linked EE0.6 sequence was successful for certain species, a single set of primers was not sufficient for wide-range sex identification (Ogawa et al. 1997). Comparison of W- and Z-linked EE0.6 sequences and selection of a suitable set of primers were necessary for successful sex identification of oriental white storks (Itoh et al. 1997). The present method of identifying the W-linked EE0.6 sequence by choosing one of the six different combinations of sexing and control primer sets and proper PCR conditions was successfully applicable for most of the Carinatae species tested. We think that advantages of the present sexing method are as follows: (1) W-specific and Z/W common (internal control) PCR products can be clearly separated by agarose-gel electrophoresis for only about 10 min; (2) the length of a W-specific PCR product is predictable because the set of primers does not encompass an intron; (3) there are choices of primer sets, which is useful for sex identification of a variety of species; and (4) a Z/W common internal control is reliable because a sequence was chosen from an exon of spindlin gene, which is well conserved as W- and Z-linked genes in all avian species examined (Itoh et al. 2001).

The present finding that EE0.6-related sequences on the Z and W chromosomes of the ostrich and emu could not be distinguished either by Southern blotting or with PCR under the six different conditions suggests that homogenization of sequences between the sex chromosome pair of the Ratitae species is rather extensive, even for a pseudo-genelike sequence of EE0.6. This situation is likely caused by the occurrence of relatively normal meiotic recombination between sex chromosomes, as suggested for the American rhea and Darwin's rhea (Pigozzi and Solari 1997, 1999). However, the finding that a part of the W chromosomal arm containing the IREBP gene is missing in the ostrich (Ogawa et al. 1998) and the cassowary (Nishida-Umehara et al. 1999), and the presence of a W-linked random amplified polymorphic DNA (RAPD) marker in the ostrich (Bello and Sánchez 1999) suggest that further extensive searches may find a suitable target sequence for PCR sexing on a certain region of the W chromosome in Ratitae species.


    Acknowledgments
 
This study was supported by grant-in-aid for scientific research (B) (2) 09556072 from the Ministry of Education, Science, Sports, and Culture, Japan (to S.M.) and Inui Memorial Trust for Research on Animal Science (to Y.I.)


    Footnotes
 
Corresponding Editor: Lyman Crittenden

Received October 14, 2000
Accepted April 3, 2001


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

    Bello M and Sánchez A, 1999. The identification of a sex-specific DNA marker in the ostrich using a random amplified polymorphic DNA (RAPD) assay. Mol Ecol 8:667–669.[Medline]

    Clinton M, 1994. A rapid protocol for sexing chick embryos (Gallus g. domesticus). Anim Genet 25:361–362.[Web of Science][Medline]

    Ellegren H, 1996. First gene on the avian W chromosome (CHD) provides a tag for universal sexing of non-ratitae birds. Proc R Soc Lond B 263:1635–1641.[Medline]

    Ellegren H and Fridolfsson A-K, 1997. Male-driven evolution of DNA sequences in birds. Nat Genet 17:182–184.[Web of Science][Medline]

    Fridolfsson A-K, Cheng H, Copeland NG, Jenkins NA, Liu H-C, Raudsepp T, Woodage T, Chowdhary B, Halverson J, and Ellegren H, 1998. Evolution of the avian sex chromosomes from an ancestral pair of autosomes. Proc Nat Acad Sci USA 95:8147–8152.[Abstract/Free Full Text]

    Gemell NJ and Akiyama S, 1996. An efficient method for the extraction of DNA from vertebrate tissues. Trends Genet 12:338–339.[Web of Science][Medline]

    Griffiths R and Korn RM, 1997. A CHD1 gene is Z chromosome linked in the chicken Gallus domesticus. Gene 197:225–229.[Web of Science][Medline]

    Griffiths R, Double MC, Orr K, and Dawson RJG, 1998. A DNA test to sex most birds. Mol Ecol 7:1071–1075.[Medline]

    Hori T, Asakawa S, Itoh Y, Shimizu N, and Mizuno S, 2000. Wpkci, encoding an altered form of PKCI, is conserved widely on the avian W chromosome and expressed in early female embryos: implication of its role in female sex determination. Mol Biol Cell 11:3645–3660.[Abstract/Free Full Text]

    Itoh Y, Hori T, Saitoh H, and Mizuno S, 2001. Chicken spindlin genes on W and Z chromosomes: transcriptional expression of both genes and dynamic behavior of spindlin in interphase and mitotic cells. Chromosome Res 9:283–299.[Web of Science][Medline]

    Itoh Y, Ogawa A, Murata K, Hosoda T, and Mizuno S, 1997. Identification of the sex of oriental white stork, Ciconia boyciana, by the polymerase chain reaction based on its sex chromosome-specific DNA sequences. Genes Genet Syst 72:51–56.[Web of Science][Medline]

    Kodama H, Saitoh H, Tone M, Kuhara S, Sakaki Y, and Mizuno S, 1987. Nucleotide sequences and unusual electrophoretic behavior of the W chromosome-specific repeating DNA units of the domestic fowl, Gallus gallus domesticus. Chromosoma 96:18–25.[Web of Science][Medline]

    Mizuno S and Macgregor H, 1998. The ZW lampbrush chromosomes of birds: a unique opportunity to look at the molecular cytogenetics of sex chromosomes. Cytogenet Cell Genet 80:149–157.[Web of Science][Medline]

    Nakabayashi O, Kikuchi H, Kikuchi T, and Mizuno S, 1998. Differential expression of genes for aromatase and estrogen receptor during the gonadal development in chicken embryos. J Mol Endocrinol 20:193–202.[Abstract]

    Nishida-Umehara C, Fujiwara A, Ogawa A, Mizuno S, Abe S, and Yoshida MC, 1999. Differentiation of Z and W chromosomes revealed by replication banding and FISH mapping of sex-chromosome-linked DNA markers in the cassowary (Aves, Ratitae). Chromosome Res 7:635–640.[Web of Science][Medline]

    Ogawa A, Murata K, and Mizuno S, 1998. The location of Z- and W-linked marker genes and sequence on the homomorphic sex chromosomes of the ostrich and the emu. Proc Natl Acad Sci USA 95:4415–4418.[Abstract/Free Full Text]

    Ogawa A, Solovei I, Hutchison N, Saitoh Y, Ikeda J, Macgregor H, and Mizuno S, 1997. Molecular characterization and cytological mapping of a non-repetitive DNA sequence region from the W chromosome of chicken and its use as a universal probe for sexing Carinatae birds. Chromosome Res 5:93–101.[Web of Science][Medline]

    O'Neill M, Binder M, Smith C, Andrews J, Reed K, Smith M, Millar C, Lambert D, and Sinclair A, 2000. ASW: a gene with conserved avian W-linkage and female specific expression in chick embryonic gonad. Dev Genes Evol 210:243–249.[Web of Science][Medline]

    Pigozzi MI and Solari AJ, 1997. Extreme axial equalization and wide distribution of recombination nodules in the primitive ZW pair of Rhea americana (Aves, Ratitae). Chromosome Res 5:421–428.[Web of Science][Medline]

    Pigozzi MI and Solari AJ, 1999. The ZW pairs of two paleognath birds from two orders show transitional stages of sex chromosome differentiation. Chromosome Res 7:541–551.[Web of Science][Medline]

    Saitoh Y, Saitoh H, Ohtomo K, and Mizuno S, 1991. Occupancy of the majority of DNA in the chicken W chromosome by bent-repetitive sequences. Chromosoma 101:32–40.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Poult. Sci.Home page
W. M. Li, Y. P. Feng, R. X. Zhao, Y. Z. Fan, N. A. Affara, J. J. Wu, J. Fang, Q Tong, C. Wang, and S. J. Zhang
Sex Ratio Bias in Early-Dead Embryos of Chickens Collected During the First Week of Incubation
Poult. Sci., November 1, 2008; 87(11): 2231 - 2233.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Itoh, Y.
Right arrow Articles by Mizuno, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itoh, Y.
Right arrow Articles by Mizuno, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?