The Journal of Heredity 2001:92(5)
© 2001 The American Genetic Association 92:375-381
Drosophila mediopunctata P Elements: A New Example of Horizontal Transfer
From the Departmento de Biologia, Universidade Federal de Santa Maria, CEP 97105-900, Santa Maria, RS, Brazil (Loreto), Departmento de Genética (Valente) and Departamento de Biologia Molecular e Biotechnologia (Zaha), Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil, National Center for Biotechnology Information, National Institutes of Health, Bethesda, MD (Silva), and Department of Ecology and Evolutionary Biology, University of Arizona, Tucson, AZ 85721 (Kidwell).
address correspondence to Margaret G. Kidwell at the address above or e-mail: kidwell{at}azstarnet.com.
| Abstract |
|---|
|
|
|---|
Sequences homologous to the P element of Drosophila melanogaster were previously identified in Drosophila mediopunctata, a member of the tripunctata group, subgenus Drosophila. We report here that the P element is present in about three to five copies in the D. mediopunctata genome. While one of the insertion sites appears to be fixed, others may be polymorphic, indicating relatively recent P element activity. Phylogenetic analysis revealed that the D. mediopunctata element belongs to the canonical subfamily of P elements and that divergence of the D. mediopunctata element from other members of this subfamily ranges from 2% to 5% at the nucleotide level. This is the first report of a canonical P element outside the subgenus Sophophora. Based primarily on the striking incongruence between P element and host species phylogenies, the presence of a canonical P element in D. mediopunctata is most likely explained by horizontal transfer between species.
| Introduction |
|---|
|
|
|---|
P elements comprise a family of transposable elements (TEs) that were first discovered in Drosophila melanogaster because of their ability to produce hybrid dysgenesis (Kidwell et al. 1977). Complete P elements are 2.9 kb long and contain four open reading frames (ORFs) (O'Hare and Rubin 1983), which encode two polypeptides, an 87 kDa transposase enzyme (Rio et al. 1986) and a 66 kDa repressor protein (Robertson and Engels 1989). Southern blot hybridization studies suggested that P elements are concentrated in species of the subgenus Sophophora in the genus Drosophila (Anxolabéhère et al. 1985; Daniels et al. 1990; Lansman et al. 1985). However, a broader distribution is suggested by weak hybridization signals in a number of additional species, including two species of the quinaria group, three species from the immigrans radiation (subgenus Drosophila), Drosophila busckii (subgenus Dorsilopha), and a few species of the subgenus Scaptodrosophila. Weak signals were also detected in drosophilids of the genera Liodrosophila and Scaptomyza (Anxolabéhère et al. 1985; Daniels et al. 1990; Lansman et al. 1985). The discovery of diverged P-homologous sequences in two nondrosophilids, the blowfly (Lucilia cuprina; Perkins and Howells 1992) and the house fly (Musca domestica; Lee et al. 1999) also suggests that this TE family may earlier have been more widely distributed than it is today.
Phylogenetic studies based on nucleotide sequences (Clark and Kidwell 1997; Hagemann et al. 1996) indicated that P elements fall into several distinct subfamilies, or clades, which, by definition, are characteristic of particular species groups. However, the P elements from some species of the subgenus Sophophora belong to more than one different subfamily, and the diversity of sequences within subfamilies can be as great as 40% (Clark and Kidwell 1997). As the subgenus Sophophora arose between 40 and 60 million years ago, it has been suggested that multiple P subfamilies could represent extant members of an ancestral P element lineage that was present in the ancestor of the subgenus. One, or more, of these subfamilies might have been present before the diversification of the species groups. Alternatively, different subfamilies could be the result of independent "waves" of horizontal transfer that swept through several species at multiple times in the past (Silva and Kidwell 2000).
The P element studied intensively in D. melanogaster is a member of the canonical subfamily whose distribution was previously found to be restricted to species of the subgenus Sophophora. With the exception of the D. melanogaster P element, all canonical elements have previously been found only in species of the willistoni and saltans species groups. The canonical D. melanogaster P element represents one of several unequivocal cases of P element horizontal transfer (Clark and Kidwell 1997; Daniels et al. 1990).
We previously described a P-homologous sequence in D. mediopunctata, a species of the tripunctata group of the subgenus Drosophila (Loreto et al. 1998). Here we report the results of a comparative analysis of P element nucleotide sequences from D. mediopunctata and a number of other species. Surprisingly, D. mediopunctata P elements belong to the canonical P element subfamily. This is the first reported case of P element horizontal transfer between species belonging to two Drosophila subgenera, and the first identification of a canonical P element outside of the subgenus Sophophora.
| Materials and Methods |
|---|
|
|
|---|
Drosophila Stocks
D. mediopunctata. All strains employed were recently derived from natural populations and subsequently maintained in the laboratory by mass matings, under standard conditions. ITL22 was collected at Itatiaia, Rio de Janeiro, Brazil, in January 1996. MPMS was collected at Morro Santana, Porto Alegre, State of Rio Grande do Sul, Southern Brazil, in December 1994. MPITA was collected at Itapuã Park, Porto Alegre, State of Rio Grande do Sul, in July 1997. MPTU was collected at Turvo Forest Park, State of Rio Grande do Sul, in June 1998.
D. melanogaster. The Harwich strain, obtained from the National Species Stock Center, Bowling Green, OH, was used as a positive control for the presence of P-homologous sequences.
Southern Blot Analysis
Genomic DNA was prepared from 2530 adult flies, according to Jowett (1986). DNA samples (6 µg) were digested with EcoRI and HindIII restriction enzymes (Gibco-BRL). The DNA fragments were separated by electrophoresis on 0.8% agarose gels and transferred to nylon membranes (Hybond N+/Amersham-Pharmacia). The membranes were hybridized to a random primer-labeled probe at 60°C in 5x SSC; 0.1% SDS; 5% dextran sulfate, and 20-fold dilution of liquid block. The filter was washed three times with 0.2x SSC and 0.5% SDS for 20 min at 60°C. Hybridization was done using the Gene Image kit (Amersham-Pharmacia), following the manufacturer's instructions.
A 2.8 kb fragment amplified by polymerase chain reaction (PCR) from the P element contained in the p
25.1 plasmid (O'Hare and Rubin 1983) was used as a probe. This fragment was obtained using primers P85 (5'GAGAGGAAAGGTTGTGTGC) and P2863 (5'TCGGCAAGAGACATCCA) (see Figure 1).
|
DNA Amplification and Sequencing
Polymerase chain reactions were carried out with 100 ng of genomic DNA from the MPMS strain in a solution of 2.5 mM MgCl2, 50 mM KCl, 200 µM of each deoxynucleotide, 100 pmol of two primers and 1.5 units of Taq polymerase in a total volume of 50 µl. PCRs consisted of 30 cycles of 45 s of denaturation at 94°C, 45 s of primer annealing at 60°C, and 1.5 min of primer extension at 72°C. In the very first cycle there was a longer denaturation period of 5 min at 95°C, and in the very last, an elongation step of 5 min at 72°C.
The P-homologous sequences were amplified using the P85 and P2863 primers. The subscript number in each primer designation corresponds to the nucleotide position it occupies in the DNA sequence of the canonical P element of D. melanogaster (O'Hare and Rubin 1983). The 2.8 kb PCR products were purified using the GFX kit (Amersham/Pharmacia) and cloned into the pGEM vector using the Easy Vector System II (Promega). To amplify the P element terminal 5' region, a primer specific to the P element's inverted terminal repeat (ITR) [primer M-IR (5'CATAAGGTGGTCCCGTCG); Haring et al. 1995] was used with the primer P901 (5'AGCAGCGACCTTCATCTC). To obtain the 3' region, the M-IR primer was used together with P2134 (5'CAGCCAGGAATACAGAAA). Genomic DNA was used as a template and PCR products of the P element terminal regions were then cloned into a TA cloning vector (INVITROGEN). Figure 1 shows the position of the primers in the P element sequence and the estimated sizes of the PCR products, as well as the location of the restriction enzyme sites.
The P element DNA sequence was obtained using automated sequencing techniques (ABI 100 automated DNA sequencer, MGF, University of Georgia, and ABI 377, in the Laboratory of Molecular Systematics and Evolution, University of Arizona). For each of the fragments amplified, three individual clones were chosen at random for sequencing. The following primers were used to sequence the 2.8 kb P-element fragment: P703 (5'AGGGCCTGCGGTGTGGAGACAAATA); P843 (5'CCTAATGGACAGTGATGG); P901 (5'AGCAGCGACCTTCATCTC); P1088 (5'AGGATATTTAGTAGTTGCTATTG); P1775 (5'TGCTTCGCTTGATGGCTT); P1825 (5'TGGTTGCGACGGCTTGTT); P2134 (5'CAGCCAGGAATACAGAAA); P2302 (5'CAACTCATCCATTTCGGT).
The DNA sequence of the D. mediopunctata P element has been deposited in GenBank (accession number AF313770).
Phylogenetic Analysis
The phylogenetic position of the D. mediopunctata P element was determined in two stages. First, we compared the D. mediopunctata element to representatives of several previously described P element subfamilies. Once it was established that the D. mediopunctata element belonged to the canonical subfamily, a second analysis was performed which included representatives of the multiple clades within this subfamily.
For the first analysis, P element nucleotide sequences from the following species were obtained from the literature: D. melanogaster p
25.1 (O'Hare and Rubin 1983); D. nebulosa N15 (Lansman et al. 1987); D. guanche G1 (Miller et al. 1992); D. bifasciata M13 (Hagemann et al. 1992); D. subobscura G2 and A1 (Paricio et al. 1991); Scaptomyza pallida S02 and S18 (Simonelig and Anxolabéhère 1991); Lucilia cuprina P1 (Perkins and Howells 1992). Nucleotide sequences of ORFs 1 and 2 were aligned manually and used to determine the phylogenetic affiliations of P elements (Clark et al. 1994; Swofford 1997).
In order to determine the phylogenetic position of the D. mediopunctata P element within the canonical clade, the following nucleotide sequences of 13 species were used: D. melanogaster, 25; D. willistoni, 13; D. paulistorum, 14; D. equinoxialis, 17; D. tropicalis, 13; D. pavlovskiana, 16; D. nebulosa, 12; D. sucinea, 1; D. fumipennis, 2 and 9; D. sturtevanti, 13; D. austrosaltans, 51; D. prosaltans, 30. An element from S. pallida, S. pallida 02, was used as the outgroup (Clark and Kidwell 1997). The comparisons were limited to a 429 bp fragment mapping to positions 1328 to 1757 in ORF 2 of the D. melanogaster P element.
The phylogenetic relationships among P sequences were reconstructed using the maximum parsimony and neighbor-joining (NJ) methods, as implemented in PAUP 4.0d54 (Swofford 1997) and MEGA (Kumar et al. 1993), respectively. Maximum parsimony searches were done using branch-and-bound. The distance matrix used for NJ was built according to the Kimura two-parameter model of nucleotide substitution (Kimura 1980). Bootstrap analyses were done using parsimony, and consisted of 500 replicates with the branch-and-bound algorithm.
| Results |
|---|
|
|
|---|
Southern Hybridization Analysis
Southern blot analysis of genomic DNA isolated from four different strains of D. mediopunctata revealed the presence of at least three to five copies of the P element per genome, depending on the strain. As the D. mediopunctata P element that we sequenced possesses a single EcoRI restriction site, we might have expected to see different hybridization bands among the different strains, indicating insertion site polymorphism. However, as seen in Figure 2 (lanes 58), two bands are present in all strains, indicating that one insertion site is fixed. Each strain has additional bands, suggesting insertion site polymorphism, but because the degree of divergence among strains is not known, the possibility of restriction site polymorphism in the host DNA flanking the P element cannot be ruled out as an alternative explanation.
|
As shown in Figure 2 (lanes 14), when genomic DNA was digested with HindIII, all the analyzed strains carried the expected 0.83 kb band. The presence in all strains of an additional 2.4 kb band indicates that at least one additional, perhaps inactive, copy has been present for some time in the genome of this species. It is likely that this copy is more divergent from the canonical element than the ones that generate the expected 0.83 kb fragment, as its restriction pattern is different from that of the canonical element. Once again, several bands were observed for different individual strains, suggesting insertion site polymorphism.
DNA Sequencing
The PCR products that were cloned and sequenced from the D. mediopunctata MPMS strain (see Materials and Methods) are 2851 bp in length, and are very similar in structure and sequence to the canonical P element from D. melanogaster. Although the ITRs were not sequenced, PCR amplification with specific primers to that region indicated that the ITRs are present. The sequenced region corresponds to nucleotide positions 32 to 2896 of the D. melanogaster p
25.1 element (O'Hare and Rubin 1983). In comparison with the D. melanogaster sequence, the D. mediopunctata P element has 93 nucleotide substitutions (corresponding to an overall divergence of 3.54%), three deletions and five insertions. These differences were present in all of the clones that were analyzed. As can be seen in Figure 3, ORF 0 contains a deletion of two nucleotides. However, because this is located before the ATG start codon, it does not produce a frameshift mutation. In the first intron there is an insertion of one nucleotide, and in the second intron there is an insertion of four nucleotides. In ORF 2 there is a deletion of 11 nucleotides that causes a frameshift mutation and a premature stop codon; an additional 1 bp insertion is located further downstream. In ORF 3 there is a deletion of seven nucleotides and an insertion of a single nucleotide.
|
Analysis of the D. mediopunctata P element sequence suggests that it retains some coding capacity. The promoter region and the splicing signals are in perfect correspondence with those of the D. melanogaster P element. The sequence is also well conserved in the regions of ORF 0 and 1. In these regions, two leucine zippers and one helix-turn-helix motif are present, which could be involved in transposase dimerization and DNA binding (Rio et al. 1986). In these motifs, only one amino acid substitution was detected, in the second leucine zipper located between D. melanogaster amino acid positions 283 and 311; this position is not critical for function of the motif. However, in ORF 2, an 11 bp deletion (located between nucleotide positions 1744 and 1755 in p
25.1) has caused a frameshift. The first stop codon appears at nucleotide position 1724, and the putative protein probably has 496 amino acids. Therefore the third leucine zipper (amino acid positions 497525 in the P transposase protein of D. melanogaster) is not present in the putative D. mediopunctata P protein.
Phylogenetic Analysis
The first aim of the phylogenetic analysis was to determine the subfamily to which the D. mediopunctata P element sequence belonged. A conserved region limited to 1336 nucleotides of ORFs 1 and 2 was analyzed from 10 different species. As seen in Table 1, the D. mediopunctata P element differed by only 3% in nucleotide sequence from that of D. melanogaster and by only 4% from that of D. nebulosa. Figure 4 summarizes the results of phylogenetic analyses of P element sequences using two different methods, parsimony and neighbor joining. Both analyses indicate that the D. mediopunctata P element clusters most closely with those of D. melanogaster and D. nebulosa, both members of the canonical P element subfamily. This result is consistent with the low genetic distances observed between the D. mediopunctata element and those of D. melanogaster and D. nebulosa. However, such a close relationship is strikingly incongruent with the phylogenetic relationships between the host species.
|
|
Having determined that the D. mediopunctata P element belongs to the canonical subfamily, we carried out a second analysis to compare this element with additional canonical P sequences whose relationships were determined earlier by Clark et al. (1995). A P sequence from Scaptomyza pallida was included as an outgroup. As can be seen in Table 2, nucleotide sequence differences are small within this subfamily, ranging from 0% to 9%. The dissimilarity between the D. mediopunctata element and other canonical P elements ranges from 2% to 5%, clearly indicating that it belongs to the canonical element subfamily.
|
Previous phylogenetic analyses (Clark et al. 1995; Clark and Kidwell 1997) divided the canonical P element subfamily into the following two groups: a clade that includes the elements from D. melanogaster and from species of the willistoni subgroup (D. willistoni, D. paulistorum, D. tropicalis, D. equinoxialis, and D. pavlovskiana), and a paraphyletic group containing P elements from the remaining species of the willistoni group (D. capricorni, D. sucinea, D. nebulosa, and D. fumipennis) and the saltans group species (D. prosaltans, D. austrosaltans, D. sturtevanti, D. saltans, and D. lusaltans). As can be seen from the phylogenetic analyses shown in Figure 5, the D. mediopunctata element is placed in the second group.
|
The close relationship found between the D. mediopunctata P element and other canonical P elements is strikingly incongruent with the phylogenetic relationships that have been documented between their host species. Whereas the majority of canonical P elements have host species belonging to the subgenus Sophophora, D. mediopunctata is a member of the tripunctata species group, which comprises 60 species in the Drosophila subgenus. With the exception of D. tripunctata, an inhabitant of the nearctic region, this group is endemic to the neotropical region, where it ranks second only to the repleta group in number of species (Vilela 1992). The members of the tripunctata species group have diverse feeding habits; some are fungivorous and some are ground feeders associated with fallen flowers, small fruits, and decaying pulpy vegetation. Figure 6 depicts the phylogenetic relationships among flies in the family Drosophilidae inferred by combined analysis of morphological and molecular characters (Remsen and O'Grady 2001). It can be seen in Figure 6 that the tripunctata group is only distantly related to the Sophophora, in which all other canonical elements are found. The canonical P elements previously identified were confined to the New World saltans and willistoni species groups, with the exception of the canonical P element in D. melanogaster, which was horizontally transmitted from D. willistoni (Clark and Kidwell 1997; Daniels et al. 1990).
|
| Discussion |
|---|
|
|
|---|
Our main findings from the study of the D. mediopunctata P elements are as follows: (1) P elements are present in relatively low copy number, in the range of three to five elements per genome. One site is fixed, but others polymorphic. (2) There has been loss of coding capacity for a full-length transposase. (3) These P elements are members of the canonical subfamily. (4) Divergence of 2% to 5% at the nucleotide level has occurred from other members of the canonical subfamily, with an estimated maximum divergence time of 2 million years (see below).
The D. mediopunctata P element copy number is significantly lower than that usually found in D. melanogaster (up to about 60 copies per genome) and also somewhat less than that observed in D. willistoni (820 per genome). However, autonomous elements are present in both of the latter two species and this is likely to be an important factor in maintaining a higher copy number. The low P element copy number and fixation pattern in D. mediopunctata are somewhat reminiscent of those observed in some species of the saltans and willistoni groups, such as D. sucinea, and some of the semispecies of D. paulistorum, whose P elements are also no longer active (Daniels and Strausbaugh 1986).
Our analysis strongly suggests that all the sampled D. mediopunctata P sequences have lost their transposase function. Although they are smaller, these sequences may have retained the essential functional features of the 66 kDa repressor protein identified in D. melanogaster (Robertson and Engels 1989). Evidence consistent with this possibility is provided by the differential divergence of different parts of P element sequences between D. mediopunctata and D. melanogaster. Compared with an overall divergence of 3.54%, the P element nucleotide divergence before the first stop codon is 2.9%. After this stop codon the divergence increases to 4.21%, suggesting that putative repressor coding sequences are more conserved than putative transposase coding sequences. A repressor might be used for defense against active invading elements (Kimura and Kidwell 1994) and might provide an explanation for the low P element copy number observed in this species. The early appearance of a repressor soon after the P element invasion of the species could have caused a decrease in transposition frequency. Subsequent mutation could then have led to the total elimination of autonomous elements at an early stage.
Our estimated range of 2% to 5% nucleotide divergence of the D. mediopunctata P element from other canonical P elements is well within the 10% range of divergence previously observed within the canonical subfamily in the Sophophora (Clark et al. 1995; Clark and Kidwell 1997). In the case of the sophophoran elements, it was concluded that the high level of sequence conservation was consistent with the hypothesis that canonical P elements were transferred to the saltanswillistoni lineage relatively recently (Clark et al. 1995). Using three different approaches, Silva and Kidwell (2000) have determined the age of the most recent common ancestor of all canonical P elements to be approximately 2 to 3 million years. Using a substitution rate of 1.6% per million years that was previously observed for Drosophila nuclear genes with low codon bias (Sharp and Li 1989), we estimate that the divergence of the D. mediopunctata element from that found in sophophoran species occurred 2 million years ago, at the most. Again, this estimate was within the range previously estimated for the canonical subfamily in Sophophora. These results are in total agreement with the phylogenetic analysis, which clearly places the D. mediopunctata element among the canonical elements.
In contrast to the low P element divergence time, the divergence of the species lineage that led to D. mediopunctata (subgenus Drosophila) from that which led to the willistoni and saltans groups (subgenus Sophophora) occurred at least 50 million years ago. A relatively recent horizontal transfer of a canonical P element into the D. mediopunctata genome best explains this incongruence. Silva and Kidwell (2000) have determined that the canonical P subfamily invaded the species of the saltans and willistoni groups in several independent horizontal transfer events, within the last 3 million years. So we can envision an evolutionary scenario in which the canonical P element entered D. mediopunctata at approximately the same time that it entered the species of the saltans and willistoni groups. Although the mechanism of horizontal transfer is unknown, the minimum requirements would be geographic, temporal, and ecological overlap between donor and recipient species. Considering that D. mediopunctata is not only sympatric with species of the willistoni and saltans groups, but also shares breeding and feeding sites with these groups in the neotropical region, it seems that all the basic requirements for such a transfer can be readily documented.
| Acknowledgments |
|---|
We thank Dr. Antônio B. Carvalho for providing the ITL22 strain and Ms. Luciano Basso da Silva who kindly provided the MPMS, MPTU, and MPITA strains. We are indebted to Andrew Holyoake for comments on the manuscript. This research was supported by FAPERGS (grant nos. 98/0437.5 and 98/0734.0) and National Science Foundation grants DEB-9701252 (to J.C.S. and M.G.K.) and DEB-9815754 (to M.G.K.).
| Footnotes |
|---|
Corresponding Editor: Stephen J. O'Brien
Received December 12, 2000
Accepted June 30, 2001
| References |
|---|
|
|
|---|
-
Anxolabéhère D, Nouaud D, and Périquet G, 1985. Séquences homologues a l'élément P chez des espèces de Drosophila du groupe obscura et chez Scaptomyza pallida (Drosophilidae). Génét Sél Evol 17:579584.
Clark JB, Altheide TK, Schlosser MJ, and Kidwell MG, 1995. Molecular evolution of P transposable elements in the genus Drosophila. I. The saltans and willistoni species groups. Mol Biol Evol 12:902913.[Abstract]
Clark JB and Kidwell MG, 1997. A phylogenetic perspective on P transposable element evolution in Drosophila. Proc Natl Acad Sci USA 94:1142811433.
Clark JB, Maddison WP, and Kidwell MG, 1994. Phylogenetic analysis supports horizontal transfer of P transposable elements. Mol Biol Evol 11:4050.[Abstract]
Daniels SB, Peterson KR, Strausbaugh LD, Kidwell MG, and Chovnick A, 1990. Evidence for horizontal transmission of the P transposable element between Drosophila species. Genetics 124:339355.[Abstract]
Daniels SB and Strausbaugh LD, 1986. The distribution of P-element sequences in Drosophila: the willistoni and saltans species groups. J Mol Evol 23:138148.[ISI][Medline]
Hagemann S, Haring E, and Pinsker W, 1996. A new P element subfamily from Drosophila tristis, D. ambigua, and D. obscura. Genome 39:978985.[Medline]
Hagemann S, Miller WJ, and Pinsker W, 1992. Identification of a complete P-element in the genome of Drosophila bifasciata. Nucleic Acids Res 20:409413.
Haring E, Hagemann S, and Pinsker W, 1995. Different evolutionary behaviour of P element subfamilies: M-type and O-type elements in Drosophila bifasciata and D. imaii. Gene 163:197202.[ISI][Medline]
Jowett T, 1986. Preparation of nucleic acids. In: Drosophila: a practical approach (Roberts DB, ed). Oxford: IRL Press.
Kidwell MG, Kidwell JF, and Sved JA, 1977. Hybrid dysgenesis in Drosophila melanogaster: a syndrome of aberrant traits including mutation, sterility and male recombination. Genetics 36:813833.
Kimura K and Kidwell MG, 1994. Differences in P element population dynamics between the sibling species Drosophila melanogaster and D. simulans. Genet Res 63:2738.[ISI][Medline]
Kimura M, 1980. A simple method for estimating evolutionary rate of base substitutions through comparative analysis of nucleotide sequences. J Mol Evol 16:111120.[ISI][Medline]
Kumar S, Tamura K, and Nei M, 1993. MEGA: molecular evolutionary genetics analysis, version 1.0. University Park, PA: Pennsylvania State University.
Lansman RA, Shade RO, Grigliatti TA, and Brock HW, 1987. Evolution of P transposable elements: sequences of Drosophila nebulosa P elements. Proc Natl Acad Sci USA 84:64916495.
Lansman RA, Stacey SN, Grigliatti TA, and Brock HW, 1985. Sequences homologous to the P mobile element of Drosophila melanogaster are widely distributed in the subgenus Sophophora. Nature 318:561563.
Lee S-H, Clark JB, and Kidwell MG, 1999. A P element-homologous sequence in the house fly, Musca domestica. Insect Mol Biol 8:491500.[ISI][Medline]
Loreto EL, da Silva LB, Zaha A, and Valente VL, 1998. Distribution of transposable elements in neotropical species of Drosophila. Genetica 101:153165.
Miller WJ, Hagemann S, Reiter E, and Pinsker W, 1992. P-element homologous sequences are tandemly repeated in the genome of Drosophila guanche. Proc Natl Acad Sci USA 89:40184022.
O'Hare K and Rubin GM, 1983. Structures of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34:2535.[ISI][Medline]
Paricio N, Perez-Alonso M, Martínez-Sebastián MJ, and De Frutos R, 1991. P sequences of Drosophila subobscura lack exon 3 and may encode a 66 kDa repressor-like protein. Nucleic Acids Res 19:67136718.
Perkins HD and Howells AJ, 1992. Genomic sequences with homology to the P element of Drosophila melanogaster occur in the blowfly Lucilia cuprina. Proc Natl Acad Sci USA 89:1075310757.
Remsen J and O'Grady PM, 2001. Phylogeny of Drosophilidae (Diptera), with comments on combined analysis, character support and phylogenetic taxonomy. Syst Biol (in review).
Rio DC, Laski FA, and Rubin GM, 1986. Identification and immunochemical analysis of biologically active Drosophila P element transposase. Cell 44:2132.[ISI][Medline]
Robertson HM and Engels WR, 1989. Modified P elements that mimic the P cytotype in Drosophila melanogaster. Genetics 123:815824.
Sharp PM and Li W-H, 1989. On the rate of DNA sequence evolution in Drosophila. J Mol Evol 28:398402.[ISI][Medline]
Silva JC and Kidwell MG, 2000. Selection and horizontal transfer in the evolution of P elements. Mol Biol Evol 17:15421557.
Simonelig M and Anxolabéhère A, 1991. A P element of Scaptomyza pallida is active in Drosophila melanogaster. Proc Natl Acad Sci USA 88:62366239.
Swofford D, 1997. PAUP: phylogenetic analysis using parsimony, version 4. Washington, DC: Smithsonian Institution.
Vilela CR, 1992. On the Drosophila tripunctata species group (Diptera, Drosophilidae). Revta Bras Ent 36:197221.
This article has been cited by other articles:
![]() |
J. C. Silva and M. G. Kidwell Evolution of P Elements in Natural Populations of Drosophila willistoni and D. sturtevanti Genetics, November 1, 2004; 168(3): 1323 - 1335. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Heredia, E. L. S. Loreto, and V. L. S. Valente Complex Evolution of gypsy in Drosophilid Species Mol. Biol. Evol., October 1, 2004; 21(10): 1831 - 1842. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


HindIII fragments (23.1 kb, 9.4 kb, 6.6 kb, 4.3 kb, 2.3 kb, and 2.0 kb).



