The Journal of Heredity 2002:93(1)
© 2002 The American Genetic Association 93:70-73
Brief Communication |
Characterization of Three Microsatellite Loci Linked to the Canine RP3 Interval
From the James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853.
Address correspondence to Dr. G. D. Aguirre at the address above or e-mail: gda1{at}cornell.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
X-linked retinitis pigmentosa (XLRP) is one of the most prevalent forms of a genetically heterogeneous group of inherited retinal disorders of man; more than 70% of XLRP families map to the RP2 or RP3 loci on the human X chromosome. Canine X-linked progressive retinal atrophy (XLPRA), observed in the Siberian husky, is the locus homologue of human RP3, but the gene responsible for XLPRA has not yet been identified. To develop polymorphic markers in the RP3 interval in dogs we have isolated microsatellites from canine BAC clones. Three tightly linked microsatellite loci, CUX20001, CUX30001, and CUX40002, have been investigated in 17 dog breeds or breed varieties. Calculated parameters of variability correspond with the number of repeats at each locus. Pedigree analyses showed tight linkage between the canine t-complex-associated testis-expressed 1-like gene (TCTE1l) and the gene ornithine carbamoyltransferase (OTC). Each microsatellite shows conservation within Canidae, and CUX20001 also amplified in Mustelidae and Ursidae. These markers represent an important tool in the fine mapping process for the canine region homologous to the RP3 disease interval and are valuable for evaluation of conservation and homology of this region among related species.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
More than 70% of human X-linked retinitis pigmentosa (XLRP) linked to the RP3 interval on human chromosome Xp21.1 is the result of mutations in the retinitis pigmentosa GTPase regulator (RPGR) gene (Vervoort et al. 2000). The human RP3 interval was localized by linkage between markers DXS1110 and DXS6679 telomeric to the genes TCTE1l and OTC, respectively (Ott et al. 1990). The interval also includes another gene, the sushi-repeat-containing protein, X chromosome (SRPX) (Meindl et al. 1996). Although the RPGR gene has been investigated in dog (Canis familiaris), and is linked to XLPRA without recombination, no disease-causing mutations have been identified (Zeiss et al. 2000). Thus a proper definition of the RP3 interval in terms of homology between dog and human, and the locations of the zero recombination boundaries becomes important in evaluating of positional candidate genes associated with canine X-linked disease.
Coverage of the canine X chromosome by either gene-based or anonymous markers is still very sparse. To begin developing a higher-resolution map for the canine RP3 interval, we have isolated microsatellites from canine BAC clones containing genes that map to this genomic region in humans. Consequently the relative location of each of the three loci to a canine X chromosomal gene is known a priori. The three microsatellites were evaluated on a panel of 17 different dog breeds or breed varieties and a range of different species including five carnivore families to examine the extent of conservation of the X chromosome within and among these species. Polymorphism for each of the microsatellites is reported in a red wolf (Canis rufus) family.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Isolation of Microsatellite Loci
RPCI-81 canine BAC clones 391N14 and 119B21, obtained from the BACPAC Resource Center (http://www.chori.org/bacpac/, updated June 2001), were chosen based on hybridization screening that identified them as positive for the genes TCTE1l and OTC, respectively. DNA was extracted using the Nucleobond AX 100 kit (Macherey & Nagel, Easton, PA) and microsatellites were isolated from BAC DNA following the protocol of Rassmann et al. (1991) with slight modifications; DNA was digested with HaeIII only, precipitated and cloned into M13mp19 vector.
Microsatellite Allele Analysis
Dog blood samples were selected where no common ancestors existed within the last three generations. Genomic DNA was isolated using standard techniques (Ausubel et al. 1999). A three-generation pedigree used to establish X-linked inheritance was bred and maintained at the Retinal Disease Studies Facility (RDSF) in Kennett Square, PA. For species other than Canis familiaris, genomic DNA was used as described previously (Zeiss et al. 1998). Polymerase chain reaction (PCR) was performed from 100 ng DNA under standard conditions using primers 5' GCAGCGTTATGCATCTGAGGTG 3' and 5' GCTT[lbATCC-CTTTGTGATCACGGA 3' for locus CUX-30001, and primers 5' GCATGGAGTTTCC-TTGC[lzTCCTC 3' and 5' TATTCAAGGTGCT-GAAT[lzGGGGA 3' for locus CUX40002. Amplicons were visualized on native 6% polyacrylamide gels by electrophoresis (PAGE). The CUX20001 locus, using primers 5' GGGTCTGAGCATGGCTTTGA 3' and 5' TTGATGCCTCGGGCTTGGG 3', was either amplified as described above or one primer was end-labeled with the isotope 
-32ATP (Ausubel et al. 1999). Radioactive PCR products were separated using 7% PAGE containing 5.6 M urea and 32% formamide and exposed to X-ray film. Every observed allele for each of the three amplified loci was sequenced on an automated sequencer (ABI Prism 373A DNA sequencer) at the core sequencing facility of Cornell University.
Cross-Species Amplification and Sequence Verification
PCR was performed on genomic DNA from eight different noncarnivore species under the same conditions as described for amplification in the domestic dog: Homo sapiens (human), Sus scrofa (pig), Bos taurus (cow), Mus musculus (mouse), Didelphis virginiana (opossum), Delphinus delphis (dolphin), Gallus gallus (chicken), and a hybrid (hinny) between Equus caballus (horse) and Equus asinus asinus (donkey). Southern blots were generated from 6% PAGE, ultraviolet (UV) cross-linked and hybridized with (CA)15, (CAT)6, and (GATA)10 probes for locus CUX20001, CUX30001, and CUX40002, respectively, in Church buffer (Ausubel et al. 1999).
The same procedure was repeated with genomic DNA obtained from five different carnivore families: Canidae (Canis lupus[gray wolf], Canis rufus[red wolf], Canis lupus arctos[Arctic wolf], Canis aureus[golden jackal], Vulpes marcotis[kit fox], Alopex lagopus[Arctic fox]); Mustelidae (Mustela putorius furo[ferret]); Ursidae (Ursus maritimus[polar bear]); Procyonidae (Ailurus fulgens[red panda]); Felidae (Felis catis[domestic cat], Panthera leo persica[Asian lion], Panthera tigris tigris[Bengal tiger], Lynx rufus[bobcat], Unica unica[snow leopard]). For the CUX20001 locus, at least one representative PCR product per carnivore family, as well as all PCR products close to the size range observed for microsatellite alleles in any dog breeds, were cloned using the Original TA Cloning Kit (Invitrogen, San Diego, CA) and sequenced.
Statistical Analysis
The number of dogs registered in the United States in 1999 was obtained from the American Kennel Club (http://www.akc.org/breeds/regstats.cfm, January 2001). Details for the Nova Scotia duck tolling (NSDT) retriever reflect the number of dogs registered at the Nova Scotia Duck Tolling Retriever Club (NSDTRC) between October 1, 1998 and October 1, 1999. Each PCR product size was correlated to the number of repeated microsatellite motifs by analysis of sequencing results. Parameters of variability were calculated using Microsat 1.5d software (http://hpgl.stanford.edu/projects/microsat/).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Microsatellite loci CUX20001 and CUX-30001 (EMBL accession nos. AJ279083 and AJ279084, respectively) were identified from BAC clone 391N14, and locus CUX-40002 (EMBL accession no. AJ279085) was isolated from clone 119B21. Each locus could be amplified from both BAC and genomic DNA with a unique product that matched the size originally determined by sequencing the M13mp19 subclone. Inheritance was tested for each of the microsatellites in a three-generation pedigree (Figure 1A). The lack of heterozygous males and the transmission of only maternal alleles to sons (Figure 1A; animals 7–10) confirmed the X-linked inheritance at each locus. Based on the known relationships between individuals within the pedigree, haplotypes were assigned to include data from all three microsatellite loci (marked as vertical rectangles and ellipses in Figure 1A). No recombination was observed between the three loci. Furthermore, we could not detect any recombination event between loci CUX20001 and CUX40002 in an expanded study of 79 informative meioses in two other unrelated pedigrees (data not shown).
|
The polymorphic status of microsatellite loci CUX20001, CUX30001, and CUX-40002 was examined in 17 different dog breeds or breed varieties using four to five chromosomes for each (Table 1), calculated as heterozygosity, mean repeat number, and number of alleles. In all cases the calculated mean repeat numbers closely matched the number of repeats initially obtained for each of the loci. Parameters of variability were correlated if calculated over all breeds (also including variance in repeat number; data not shown), although some deviation can be found within single breeds or breed varieties. Of interest, no correlation was observed between heterozygosity or allele number and the number of registered dogs per breed or breed variety.
|
PCR analysis was performed in several different species to examine conservation of microsatellite loci CUX20001, CUX30001, and CUX40002. None of the eight noncarnivore species or hybrids tested (human, pig, cow, mouse, opossum, dolphin, chicken, hinny) revealed an amplification product of the correct size, nor did any of the resulting PCR products hybridize to the corresponding microsatellite-specific probe (data not shown). To test for the presence of the microsatellite loci in other carnivores, the same procedure was repeated with genomic DNA obtained from Canidae, Mustelidae, Ursidae, Procyonidae, Felidae (Figure 2). While loci CUX30001 and CUX40002 amplified and hybridized positively in Canidae only, locus CUX20001 yielded PCR products of the expected size range in all carnivore species tested except red panda and Felidae. PCR products in those two families were shorter than the products obtained from other carnivores, and amplicons did not hybridize to the corresponding microsatellite motif. Sequencing confirmed (data not shown) the presence and absence, respectively, of the microsatellite motif at CUX20001 in agreement with positive or negative hybridization results.
|
To account for stutter bands caused by slippage events (Hauge and Litt 1993), only individuals bearing two bands of the same intensity were assigned to be heterozygous. In addition, we have previously shown that microsatellites that contain a CA/GT motif show a duplication of each single band when separated under nondenaturing conditions (Zeiss et al. 1998). For locus CUX20001, only the shorter product of each doublet was counted. Therefore the only observed heterozygosity in the tested panel was in the domestic dog and the golden jackal at loci CUX20001 and CUX40002 (Figure 2). Furthermore, a small pedigree of interrelated red wolves, consisting of nine individuals, was tested for each microsatellite locus. Loci CUX20001 and CUX30001 were both monomorphic within that pedigree (data not shown), but we did observe an inherited polymorphism at locus CUX40002 (Figure 1B). The alleles observed at this locus in red wolves are also present in dogs.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To develop microsatellite markers located in the canine equivalent of the human RP3 interval, three novel markers were characterized: two, CUX2001 and CUX30001, originated from a BAC containing the TCTE1l gene, and CUX40002 originated from a BAC covering the OTC gene. Assuming conservation of gene order between man and dog for this part of the X chromosome, CUX40002 would correspond to the centromeric border of the RP3 zero recombination region while CUX2001 and CUX3001 would be located within the RP3 interval, near the telomeric border (Meindl et al. 1996). We found no recombination between these three markers in three unrelated pedigrees (87 informative meiosis). Although the number of investigated chromosomes is too small to reliably detect rare recombination events, we can conclude that the two investigated chromosomal locations are closely linked in dog as in man.
Our study shows a correlation between variability and the average repeat number for microsatellite loci CUX20001, CUX30001, and CUX40002 (Table 1), a phenomenon generally recognized for such markers (Weber 1990). This overall variability is generally lower within single breeds or breed varieties, which could well be accounted for by the small sample size per breed, although positive selection at a neighboring locus (Smith and Haigh 1974) or a founder effect (David and Capy 1988; Irvin et al. 1998) may at least partially cause some of this reduced variation. Modern dog breeds are of recent origin and many popular breeds, such as Labrador retriever, expanded the effective population size shortly after the homogenization of the breed standard. Thus different ancient haplotypes should be conserved in those populations and reduce genetic drift to a negligible level (Nichols and Beaumont 1996). Therefore the observed overall variability most likely reflects the level of heterozygosity of an assumed large ancestral population (Vila et al. 1999). Breeds that have experienced several bottlenecks, like the Portuguese water dog, or have a small population size, like the standard schnauzer, show fewer alleles and reduced heterozygosity compared to other breeds or breed varieties (Table 1). However, the variability was not correlated with the number of registered dogs, although those numbers might be a rough estimate of the actual breeding populations within the United States. While extreme homogeneity might be a problem of single breeds or breed varieties (Jeffreys and Morton 1987), our study suggests that most breeds still retain high levels of heterozygosity, at least for some of the loci tested.
The recent common ancestry of Canidae species is reflected in the interspecies conservation of these three microsatellite loci. For each locus, genomic DNA from all members of the Canidae family tested could be PCR amplified, and sequencing of the amplicons confirmed the identity of the microsatellite motif. These microsatellites therefore also offer a suitable tool for evaluation of conservation and homology in this region within Canidae.
|
Acknowledgments |
|---|
We thank Keith Watamura for technical assistance with the graphics and imaging. Dr. James Kijas's critical comments on the manuscript were greatly appreciated. This research was supported by NEI grants EY06855 and EY13132, The Foundation Fighting Blindness, The Morris Animal Foundation/The Seeing Eye, Inc., Van Sloun Fund for Canine Genetic Research, and the Baker Institute Inherited Eye Disease Gift Fund.
|
Footnotes |
|---|
Corresponding Editor: Stephen J. O'Brien
Received January 26, 2001
Accepted September 15, 2001
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, and Struhl K, 1999. Current protocols in molecular biology. New York: Greene Publishing.
David JR and Capy P, 1988. Genetic variation of Drosophila melanogaster natural populations. Trends Genet 4:106–111.[CrossRef][Web of Science][Medline]
Hauge XY and Litt M, 1993. A study of the origin of "shadow bands" seen when typing dinucleotide repeat polymorphisms by the PCR. Hum Mol Genet 2:411–415.
Irvin SD, Wetterstrand KA, Hutter CM, and Aquadro CF, 1998. Genetic variation and differentiation at microsatellite loci in Drosophila simulans. Evidence for founder effects in new world populations. Genetics 150:777–790.
Jeffreys AJ and Morton DB, 1987. DNA fingerprints of dogs and cats. Anim Genet 18:1–15.
Meindl A, Dry K, Herrmann K, Manson F, Ciccodicola A, Edgar A, Carvalho MRS, Achatz H, Hellebrand H, Lennon A, Migliaccio C, Porter K, Zrenner E, Bird A, Jay M, Lorenz B, Wittwer B, D'Urso M, Meitinger T, and Wright A, 1996. A gene (RPGR) with homology to the RCC1 guanine nucleotide exchange factor is mutated in X-linked retinitis pigmentosa (RP3). Nat Genet 13:35–42.[CrossRef][Web of Science][Medline]
Nichols RA and Beaumont MA, 1996. Is it ancient or modern history that we can read in the genes? In: Aspects of the genesis and maintenance of biological diversity (Hochberg M, Clobert J, and Barbault R, eds). Oxford: Oxford University Press.
Ott J, Bhattacharya S, Chen JD, Denton MJ, Donald J, Dubay C, Farrar GJ, Fishman GA, Frey D, Gal A, Humphries P, Jay B, Jay M, Litt M, Maechler M, Musarella M, Neugebauer M, Nussbaum RL, Terwilliger JD, Weleber RG, Wirth B, Wong F, Worton RG, and Wright AF, 1990. Localizing multiple X chromosome-linked retinitis pigmentosa loci using multilocus homogeneity tests. Proc Natl Acad Sci USA 87:701–704.
Rassmann K, Schlotterer C, and Tautz D, 1991. Isolation of simple-sequence loci for use in polymerase chain reaction-based DNA fingerprinting. Electrophoresis 12(2–3):113–118.[CrossRef][Web of Science][Medline]
Smith JM and Haigh J, 1974. The hitch-hiking effect of a favourable gene. Genet Res 23:23–35.[Web of Science][Medline]
Vervoort R, Lennon A, Bird AC, Tulloch B, Axton R, Miano MG, Meindl A, Meitinger T, Ciccodicola A, and Wright AF, 2000. Mutational hot spot within a new RPGR exon in X-linked retinitis pigmentosa. Nat Genet 25:462–466.[CrossRef][Web of Science][Medline]
Vila C, Maldonado JE, and Wayne RK, 1999. Phylogenetic relationships, evolution, and genetic diversity of the domestic dog. J Hered 90:71–77.
Weber JL, 1990. Human DNA polymorphisms and methods of analysis. Curr Opin Biotechnol 1:166–171.[CrossRef][Medline]
Zeiss CJ, Trepanier LA, Aguirre GD, and Ray K, 1998. A highly conserved microsatellite in the dystrophin gene of diverse mammalian species. Anim Genet 29:224–227.[CrossRef][Web of Science][Medline]
Zeiss CJ, Ray K, Acland GM, and Aguirre GD, 2000. Mapping of X-linked progressive retinal atrophy (XLPRA), the canine homolog of retinitis pigmentosa 3 (RP3). Hum Mol Genet 9:531–537.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  B. Zangerl, J. L. Johnson, G. M. Acland, and G. D. Aguirre Independent Origin and Restricted Distribution of RPGR Deletions Causing XLPRA J. Hered., August 1, 2007; (2007) esm060v2. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||