The Journal of Heredity 2002:93(2)
© 2002 The American Genetic Association 93:119-124
Structure, Chromosomal Location, and Analysis of the Canine Cu/Zn Superoxide Dismutase (SOD1) Gene
From the Department of Comparative Medicine, Stanford University School of Medicine, Stanford, CA 94305 (Green, Tolwani, Varma, and Cork), and the CNRS UMR6061 Facultáe de Máedecine, Universitáe de Rennes, 2 avenue du Professeur Láeon Bernard, F-35043 Rennes Cáedex, France (Quignon and Galibert).
Address correspondence to Sherril L. Green, Department of Comparative Medicine, Stanford University School of Medicine, RAF 1, Quad 7, Bldg. 330, Stanford, CA 94305, or e-mail: Sherril{at}leland.stanford.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
Mutations in Cu/Zn superoxide dismutase (SOD1), a major cytosolic antioxidant enzyme in eukaryotic cells, have been reported in approximately 20% of familial amyotrophic lateral sclerosis (FALS) patients. Hereditary canine spinal muscular atrophy (HCSMA), a fatal inherited motor neuron disease in Brittany spaniels, shares many clinical and pathological features with human motor neuron disease, including FALS. The SOD1 coding region has been sequenced and cloned from several animal species, but not from the dog. We have mapped the chromosomal location, sequenced, and characterized the canine SOD1 gene. Extending this analysis, we have evaluated SOD1 as a candidate for HCSMA. The 462 bp SOD1 coding region in the dog encodes 153 amino acid residues and exhibits more than 83% and 79% sequence identity to other mammalian homologues at both the nucleotide and amino acid levels, respectively. The canine SOD1 gene maps to CFA31 close to syntenic group 13 on the radiation hybrid (RH) map in the vicinity of sodium myo/inositol transporter (SMIT) gene. The human orthologous SOD1 and SMIT genes have been localized on HSA 21q22.1 and HSA 21q21, respectively, confirming the conservation of synteny between dog syntenic group 13 and HSA 21. Direct sequencing of SOD1 cDNA from six dogs with HCSMA revealed no mutations. Northern analysis indicated no differences in steady-state levels of SOD1 mRNA.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
Copper/zinc (Cu/Zn) superoxide dismu-chtase (SOD1) is a cytosolic enzyme that cat-alyzes the conversion of the superoxide free radical (O2) into O2 and H2O2 in eu-karyotic cells (Bannister et al. 1991; Fri dovich 1986a). SOD1 and other superoxide dismutases are key components of cellular antioxidant defense (Fridovich 1986a; Halliwell 1992). Missense mutations in the SOD1 gene are responsible for approximately 20% of familial amyotrophic lateral sclerosis (FALS) cases (Orrell 2000), a fatal human motor neuron disease characterized by muscle weakness and atrophy, and degeneration of the anterior horn cells and corticospinal tracts (Hirano 1996). Since the original reports (Deng et al. 1993; Hirano et al. 1994; Pramatarova et al. 1994, 1995; Robberecht et al. 1994; Rosen et al. 1993), more than 63 SOD1 mutations associated with amyotrophic lateral sclerosis (ALS) have been described (Orrell 2000). Most are single missense mutations in exons 1, 2, 4, and 5 that collectively alter 18 different amino acids (Orrell 2000). Data from various transgenic mice (Gurney et al. 1994) suggest that the SOD1 mutations are associated with a toxic function of the enzyme, rather than through loss or gain of SOD1 activity, although the exact mechanism is unknown.
Hereditary canine spinal muscular atrophy (HCSMA) in Brittany spaniels is a well-characterized autosomal dominantly inherited motor neuron disease that shares many clinical and pathological features with human motor neuron disease, including ALS (Cork 1991; Cork et al. 1979, 1980, 1982a,b, 1988, 1990; Lorenz et al. 1979). HCSMA is phenotypically similar to juvenile spinal muscular atrophy (SMA), but the mutations in the survival motor neuron gene reported for human SMA are not present in HCSMA (Blazej et al. 1998). HCSMA is characterized by progressive muscle weakness and atrophy, and motor neuron swellings filled with accumulations of misoriented extensively phosphorylated heavy neurofilament protein (Cork 1991; Cork et al. 1979, 1980, 1982a,b, 1990; Hirano 1996; Lorenz et al. 1979; Mitsumoto 1994). Homozygous pups develop disease by 6–8 weeks. Clinical signs rapidly progress to paralysis by 12–16 weeks of age. Most pups are euthanized by 6 months of age due to complications related to swallowing and breathing difficulties. Affected heterozygotes have a more slowly progressive form of the disease with a later onset, at 6 months–2 years of age, and they may survive 7 years or longer (Cork et al. 1982a, 1988). Linkage analysis for this pedigree is not yet complete, and although we have recently excluded the canine heavy neurofilament gene as a candidate for HCSMA (Green SL, unpublished observation), the genetic etiology of the disease in dogs is unresolved.
The SOD1 coding region has been sequenced and cloned from several animal species, including the rat, rabbit, mouse, cow, pig, and horse, but not from the dog. Until now only the partial canine expressed sequence tag (EST I) sequence for SOD1 has been available (GenBank accession number AW784326). Based on the function of SOD1, the evidence of oxidant stress injury in HCSMA (Green et al., 2001), and the data implicating SOD1 as a cause of motor neuron disease in humans and transgenic mice, we considered the gene as a candidate for inherited canine motor neuron disease. We have mapped the chromosomal location, sequenced, and analyzed canine SOD1 from six healthy dogs and six HCSMA affected dogs.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
Animals Used
Archival thoraco-lumbar spinal cord and spleen from six neurologically normal, mixed-breed control dogs (three adult dogs, three pups) and six dogs from the HCSMA kindred (three affected heterozygote adults, three homozygote pups) were used in this study. Animals were euthanized with an intravenous overdose of sodium pentobarbital and transcardially perfused with chilled 0.9% saline. Tissues were immediately collected after the saline perfusion and either frozen at -80°C or immersion fixed. Fixed tissues were processed in paraffin, sectioned, and stained with hematoxylin and eosin. The diagnosis of HCSMA was histologically confirmed by the presence of muscle atrophy, and by neuronal chromatolysis and axonal swellings filled with misoriented neurofilaments in the ventral horn of the spinal cord, as has been previously described (Cork 1991; Cork et al. 1979, 1980, 1982b; Hirano 1996; Lorenz et al. 1979; Mitsumoto 1994). Animal housing and procedures were performed according to the animal protocol approved for this study by the Stanford University Institutional Animal Care and Use Committee.
|
Isolation and Sequencing of Canine SOD1 |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
Reverse transcription polymerase chain reaction (RT-PCR) was used to sequence the SOD1 cDNA from the normal dogs and HCSMA dogs described above. The forward primer, SOD1-IF (Table 1), is based on the canine SOD1 EST sequence (GenBank accession number AW784326; 72–89 bases). The reverse primer, SOD1-IVR (Table 1), is based on the human SOD1 mRNA sequence (GenBank accession number K00065; 471–451 bases). Both primers contain the ATG start codon and the TAA stop codon. The total RNA was extracted from the spinal cord using the Ultraspec RNA Isolation System (Biotecx, Houston, TX), according to the manufacturer's protocol. The total RNA was DNase treated with DNase I (Rnase-free) (Ambion, Inc., Austin, TX), as per the manufacturer's protocol. The DNase-free RNA was then reverse transcribed and PCR amplified using the SOD1 primers IF and IVR using the SuperScript one-step RT-PCR system (GIBCO BRL, Rockville, MD).
|
The SuperScript one-step RT-PCR system consists of two major components: Superscript II RT/Taq mix and 2x reaction mix (a buffer containing 0.4 mM of each dNTP, 2.4 mM MgSO4). The RT/Taq mix contains a mixture of Superscript II reverse transcriptase and Taq DNA polymerase for optimal cDNA synthesis and PCR amplification. The 2x reaction mix consists of a buffer system optimized for reverse transcription and PCR amplification, Mg2+ optimized for universal use, deoxyribonucleotide triphosphates, and stabilizers. The RT-PCR conditions included initial cDNA synthesis at 50°C for 30 min; denaturing at 94°C for 2 min; followed by amplification of the cDNA with specific primers, starting with denaturing at 94°C for 25 s, annealing at 55°C for 40 s, and extension at 72°C for 1 min. The PCR was repeated for 40 cycles, with a final extension at 72°C for 7 min.
The PCR products were purified with the QIAEX II gel extraction kit (Qiagen, Valencia, CA) and the sequence was determined by the dideoxy Taq dye determination method at the Stanford University PAN Sequencing Facility. Automated sequencing of the entire SOD1 coding region was completed in a single run using primer SOD1-IF and primer SOD1-IVR (Table 1). Genomic DNA was isolated from three normal dog spleens for PCR to identify splice sites. The primers, as shown in Table 1, were based on the SOD1 cDNA sequence from the normal dogs, as shown in Figure 1. Taq DNA polymerase recombinant (GIBCO BRL) was used for PCR and the conditions were 95°C for 4 min to completely denature the template, followed by 40 cycles of 94°C for 45 s, 50–55°C for 30 s, and 72°C for 1 min 20 s, and incubated for an additional 7 min at 72°C for the final extension. To screen for mutations in the SOD1 gene in HCSMA dogs, we sequenced the RT-PCR-generated SOD1 cDNAs from six individual HCSMA dogs (three affected adult heterozygotes and three homozygous pups) and six closely age-matched control dogs not related to this kindred (three normal adult dogs and three normal pups). Sequencing was performed on both strands using SOD1 primers IF and IVR (Table 1).
|
). Asterisk (*) indicates stop codon. |
Positioning of the Canine SOD1 Gene on the Canine RH Map |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
For RH mapping, PCR primer pair SOD1-IIIF (cDNA nt position 200–233): 5' ATCCTCTGTCCAGAAAACATG 3' and SOD1-IIIR (cDNA nt position 349–329) 5' GGCCAATGATGGAATAGTCTC 3' (as shown in Table 1) generated a 1106 bp fragment using genomic DNA from the normal dogs. This fragment encodes the third intron, which was used for positioning SOD1 on the canine RH map.
|
Radiation Hybrid Typing |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
Amplification of the marker was tested using standard conditions on dog and hamster DNA and on a mixture (1:3) of dog and hamster DNA. Amplification was performed in 10 µl reactions containing 50 ng DNA, 0.3 µM of each primer, 200 µM of each dNTP (Amersham Pharmacia Biotech, Buckinghamshire, England), 2 mM MgCl2+, 1x AmpliTaq buffer, and 0.5 U AmpliTaq Gold (Perkin-Elmer, Boston, MA). PCRs were carried out in PTC-200 PCR machines (MJ Research, Waltham, MA) with the following program: 94°C for 8 min, followed by 40 cycles of 94°C for 30 s, 55°C for 45 s, 72°C for 1 min, and a final extension of 72°C for 7 min. The marker gave a 1 kb band on dog DNA and a 600 bp band on hamster DNA, allowing the typing of this marker on the radiation hybrid panel RHDF5000 (Vignaux et al. 1999) using the above conditions. PCR products were loaded on 2% agarose gels and run in 0.5x TBE containing EtBr at 130 V for 30 min. Products were visualized under ultraviolet light, images were recorded, and results were scored in terms of present, absent, or ambiguous in the 126 hybrid cell lines. The typing data were incorporated into the latest radiation hybrid map (Mellersh et al. 2000) using the Multimap package (Matise et al. 1994). More information on RH mapping can be found at http://www-recomgen.univ-rennes1.fr/doggy.html.
|
Northern Blot Analysis |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
Northern blot analysis was performed on the total RNA extracted from the lumbar spinal cord of six control dogs (three normal adult dogs and three normal pups) and six HCSMA dogs (three affected heterozygote adult dogs and three homozygote pups) and probed for SOD1 mRNAs. Ten micrograms of total RNA was electrophoresed on an 0.8% agarose-formaldehyde gel, transferred to nitrocellulose filter (Hybond N; Amersham Pharmacia Biotech), and subsequently hybridized with SOD1 and actin RT-PCR-generated probes. The SOD1 probes (Table 1) were based on the normal dog cDNA sequence (Figure 1). SOD1-VF (nt 50–69), 5' GGAGGGCACCATCCACTTC 3', and SOD1-VR (nt 299–279), 5' GACACAATGGCCACGCCATC 3', yielded a 310 bp product. This fragment was gene cleaned (QIAEX II, Qiagen, Valencia, CA) and labeled with
-32p dCTP (Amersham Pharmacia Biotech) using the random primer DNA labeling kit (GIBCO BRL). As an internal control, the relative abundance of actin was determined using mouse-specific RT-PCR-generated actin probes: actin forward primer (139–160), 5' CATGGCATTATCACCAAC 3', and actin reverse primer (947–957), 5' GTGGACAGAGAGGCCAGG 3', based on mouse mRNA sequence (GenBank accession number XO3767). The Northern blot was hybridized under high-stringency conditions (42°C in 2x SSC, 50% formamide, 10% dextran sulfate, 5x Denhardt's reagent, 1% SDS, salmon sperm DNA) for 18 h. The hybridized filter was washed twice in 4x SSC, 0.1% SDS and twice in 2x SSC, 0.1% SDS at 55°C for 1 h. The filter was exposed to autoradiographic film (Hyperfilm MP; Amersham Pharmacia Biotech). The film was scanned using AGFA scanner (Arcus II). The bands were quantitated using NIH Image version 1.62.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
Sequence and Analysis of Canine SOD1
The canine SOD1 cDNA coding region is 462 nts long, encoding a deduced 153 amino acid protein (Figure 1). The intron/exon boundaries are indicated in Figure 1 and characterized in Table 2. While SOD1 nt and amino acid sequences are highly conserved between the species, canine SOD1 shares the greatest nt similarity with bovine and equine SOD1 (93% and 90%, respectively) (Table 3). Canine, human, and mouse SOD1 share more than 83% and 79% similarity at the nt and amino acid levels, respectively (Figure 2). Comparing the deduced amino acid sequence of canine SOD1 with human and mouse SOD1 (Figure 2) shows that the variability is in the regions of ß strands 2 and 3, the active site loop between ß strands 4 and 5, and within the Greek key loop IV.
|
|
|
|
Position of Canine SOD1 on the Radiation Hybrid Map |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
The canine SOD1 gene was mapped on the RHDF5000 dog/hamster radiation hybrid panel (Vignaux et al. 1999) using the last RH map version (Mellersh et al. 2000). It is linked to CFA31 (Breen et al. 2001) close to syntenic group 13 and near FH2239, in the region of the SMIT gene (Figure 3).
|
|
Analysis of SOD1 in Dogs with Motor Neuron Disease |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
cDNA and genomic (Fridovich 1986a,b) sequences from control dogs and HCSMA dogs were compared to identify polymorphisms. There were no nt or amino acid differences between control and HCSMA dogs. The amino acid residues where missense mutations have been reported in FALS (Orrell 2000) were conserved in the dogs except in codons 21 and 90. Divergences in these two codons resulted in an amino acid change and the substitution of a V in the canine sequence where an E is present in the human sequence at codon 21, and substitution of a G in the canine sequence where a D is present in the human codon 90. No other mutations were detected in dogs with HCSMA. Steady-state SOD1 mRNA expression levels were identical in all dogs (data not shown), the relative abundance of actin was equal in all cases.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
Canine SOD1 shares high sequence identity with other mammalian SOD1, and the variable regions we describe in canine SOD1 are consistent with variable regions described in other mammalian SOD1 (Bannister et al. 1991). The divergences at canine codons 21 and 90 which resulted in amino acid substitutions are not associated with canine motor neuron disease, though mutations at these codons have been reported in ALS (Andersen et al. 1996, 1997; Jones et al. 1995; Morita et al. 1998). Our mapping data positioning the canine SOD1 gene on CFA31 (Breen et al. 2001) near syntenic group 13 confirms conservation of synteny between dog syntenic group 13 and HSA 21. Human SOD1 spans 11 kb on chromosome 21 and encodes the homodimeric enzyme of approximately 16 kDa and 153 amino acids per subunit (Levanon et al. 1985). The orthologous human SMIT gene is localized on chromosome 21q21, which is in perfect accordance with the localization of the human orthologous SOD1 gene (21q22.1). Lastly, the data provided from direct sequencing of SOD1 cDNA and northern analysis of mRNA in the six HCSMA affected dogs indicate that mutations in the SOD1 gene are not the underlying genetic defect in these individuals. Given the limited number of animals examined, SOD1 cannot definitively be ruled out as the underlying genetic defect in the HCSMA colony. However, in the six HCSMA dogs studied here, other candidate genes, perhaps some not yet considered in human motor neuron disease, should be investigated.
|
Acknowledgments |
|---|
This work was supported by PHS grant PA95-049 (to S.L.G.), PHS grant RR00129-02 (to R.J.T.) PHS grant NS31621 (to M.J.P.), and funds from the CNRS (to F.G.). Pascale Quignon is supported by a fellowship from the Coinseil Régional de Bretagne. We thank Dr. Greg Cox and Janis Atuk-Jones for their assistance. The nucleotide sequence data reported in this article have been submitted to GenBank, accession number AF346417.
|
Footnotes |
|---|
Corresponding Editor: Stephen J. O'Brien
Received March 21, 2001
Accepted November 29, 2001
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsIsolation and Sequencing of...Positioning of the Canine...Radiation Hybrid TypingNorthern Blot AnalysisResultsPosition of Canine SOD1...Analysis of SOD1 in...DiscussionReferences |
|---|
-
Andersen PM, Forsgren L, Binzer M, Nilsson P, Ala-Hurula V, Keranen ML, Bergmark L, Saarinen A, Haltia T, Tarvainen I, Kinnunen E, Udd B, and Marklund SL, 1996. Autosomal recessive adult-onset amyotrophic lateral sclerosis associated with homozygosity for Asp90Ala CuZn-superoxide dismutase mutation. A clinical and genealogical study of 36 patients [published erratum appears in Brain 1998;121:187]. Brain 119:1153–1172.
Andersen PM, Nilsson P, Keranen ML, Forsgren L, Hagglund J, Karlsborg M, Ronnevi LO, Gredal O, and Marklund SL, 1997. Phenotypic heterogeneity in motor neuron disease patients with CuZn-superoxide dismutase mutations in Scandinavia. Brain 120:1723–1737.
Bannister WH, Bannister JV, Barra D, Bond J, and Bossa F, 1991. Evolutionary aspects of superoxide dismutase: the copper/zinc enzyme. Free Radic Res Commun 12–13:349–361.
Blazej RG, Mellersh CS, Cork LC, and Ostrander EA, 1998. Hereditary canine spinal muscular atrophy is phenotypically similar but molecularly distinct from human spinal muscular atrophy. J Hered 89:531–537.
Breen M, Jouquand S, Renier C, Mellersh CS, Hitte C, Holmes NG, Cheron A, Suter N, Vignaux F, Bristow AE, Priat C, McCann E, Andre C, Boundy S, Gitsham P, Thomas R, Bridge WL, Spriggs HF, Ryder EJ, Curson A, Sampson J, Ostrander EA, Binns MM, and Galibert F, 2001. Chromosome-specific single-locus FISH probes allow anchorage of an 1800-marker integrated radiation-hybrid/linkage map of the domestic dog genome to all chromosomes. Genome Res 11:1784–1795.
Cork LC, 1991. Hereditary canine spinal muscular atrophy: an animal model of motor neuron disease. Can J Neurol Sci 18:432–434.[Web of Science][Medline]
Cork LC, Adams RJ, Griffin JW, and Price DL, 1982a. Hereditary canine spinal muscular atrophy: a canine model of human motor neuron disease. Prog Clin Biol Res 94:449–458.[Medline]
Cork LC, Griffin JW, Adams RJ, and Price DL, 1980. Animal model of human disease: motor neuron disease: spinal muscular atrophy and amyotrophic lateral sclerosis. Am J Pathol 100:599–602.[Web of Science][Medline]
Cork LC, Griffin JW, Choy C, Padula CA, and Price DL, 1982b. Pathology of motor neurons in accelerated hereditary canine spinal muscular atrophy. Lab Invest 46:89–99.[Web of Science][Medline]
Cork LC, Griffin JW, Munnell JF, Lorenz MD, and Adams RJ, 1979. Hereditary canine spinal muscular atrophy. J Neuropathol Exp Neurol 38:209–221.[Web of Science][Medline]
Cork LC, Price DL, Griffin JW, and Sack GHJ, 1990. Hereditary canine spinal muscular atrophy: canine motor neuron disease. Can J Vet Res 54:77–82.[Web of Science][Medline]
Cork LC, Troncoso JC, Klavano GG, Johnson ES, Sternberger LA, Sternberger NH, and Price DL, 1988. Neurofilamentous abnormalities in motor neurons in spontaneously occurring animal disorders. J Neuropathol Exp Neurol 47:420–431.[Web of Science][Medline]
Deng HX, Hentati A, Tainer JA, Iqbal Z, Cayabyab A, Hung WY, Getzoff ED, Hu P, Herzfeldt B, and Roos RP, 1993. Amyotrophic lateral sclerosis and structural defects in Cu,Zn superoxide dismutase. Science 261:1047–1051.
Fridovich I, 1986a. Biological effects of the superoxide radical. Arch Biochem Biophys 247:1–11.[CrossRef][Web of Science][Medline]
Fridovich I, 1986b. Superoxide dismutases. Adv Enzymol Rel Areas Mol Biol 58:61–97.[Web of Science][Medline]
Green SL, Bouley DM, Pinter MJ, Cork LC, and Vatassery GT, 2001. Canine motor neuron disease: clinicopathological features and selected indicators of oxidative stress. J Vet Int Med 15:112–119.[CrossRef]
Gurney ME, Pu H, Chiu AY, Dal Canto MC, Polchow CY, Alexander DD, Caliendo J, Hentati A, Kwon YW, and Deng HX, 1994. Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 264:1772–1775.
Halliwell B, 1992. Reactive oxygen species and the central nervous system. J Neurochem 59:1609–1623.
Hirano A, 1996. Neuropathology of ALS: an overview. Neurology 47:S63–S66.[Web of Science][Medline]
Hirano M, Fujii J, Nagai Y, Sonobe M, Okamoto K, Araki H, Taniguchi N, and Ueno S, 1994. A new variant Cu/Zn superoxide dismutase (Val7
Glu) deduced from lymphocyte mRNA sequences from Japanese patients with familial amyotrophic lateral sclerosis. Biochem Biophys Res Commun 204:572–577.[CrossRef][Web of Science][Medline]
Jones CT, Swingler RJ, Simpson SA, and Brock DJ, 1995. Superoxide dismutase mutations in an unselected cohort of Scottish amyotrophic lateral sclerosis patients. J Med Genet 32:290–292.
Levanon D, Lieman-Hurwitz J, Dafni N, Wigderson M, Sherman L, Bernstein Y, Laver-Rudich Z, Danciger E, Stein O, and Groner Y, 1985. Architecture and anatomy of the chromosomal locus in human chromosome 21 encoding the Cu/Zn superoxide dismutase. EMBO J 4:77–84.[Web of Science][Medline]
Lorenz MD, Cork LC, Griffin JW, Adams RJ, and Price DL, 1979. Hereditary spinal muscular atrophy in Brittany spaniels: clinical manifestations. J Am Vet Med Assoc 175:833–839.[Web of Science][Medline]
Matise TC, Perlin M, and Chakravarti A, 1994. MultiMap: an expert system for automated genetic linkage mapping. Nat Genetics 4:384–390.
Mellersh CS, Hitte C, Richman M, Vignaux F, Priat C, Jouquand S, Werner P, Andre C, DeRose S, Patterson DF, Ostrander EA, and Galibert F, 2000. An integrated linkage-radiation hybrid map of the canine genome. Mamm Genome 11:120–130.[CrossRef][Web of Science][Medline]
Mitsumoto H, 1994. Classification and clinical features of amyotrophic lateral sclerosis. In: Amyotrophic lateral sclerosis. A comprehensive guide to management. New York: Demos.
Morita M, Abe K, Takahashi M, Onodera Y, Okumura H, Niino M, Tashiro K, Nakano I, and Itoyama Y, 1998. A novel mutation Asp90Val in the SOD1 gene associated with Japanese familial ALS. Eur J Neurol 5:389–392.
Orrell RW, 2000. Amyotrophic lateral sclerosis: copper/zinc superoxide dismutase (SOD1) gene mutations. Neuromusc Disord 10:63–68.[CrossRef][Web of Science][Medline]
Pramatarova A, Figlewicz DA, Krizus A, Han FY, Ceballos-Picot I, Nicole A, Dib M, Meininger V, Brown RH, and Rouleau GA, 1995. Identification of new mutations in the Cu/Zn superoxide dismutase gene of patients with familial amyotrophic lateral sclerosis. Am J Hum Genet 56:592–596.[Web of Science][Medline]
Pramatarova A, Goto J, Nanba E, Nakashima K, Takahashi K, Takagi A, Kanazawa I, Figlewicz DA, and Rouleau GA, 1994. A two basepair deletion in the SOD 1 gene causes familial amyotrophic lateral sclerosis. Hum Mol Genet 3:2061–2062.
Robberecht W, Sapp P, Viaene MK, Rosen D, McKenna-Yasek D, Haines J, Horvitz R, Theys P, and Brown RJ, 1994. Cu/Zn superoxide dismutase activity in familial and sporadic amyotrophic lateral sclerosis. J Neurochem 62:384–387.
Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, and Deng HX, 1993. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis [published erratum appears in Nature 1993;364(6435):362]. Nature 362:59–62.[CrossRef][Medline]
Vignaux F, Hitte C, Priat C, Chuat JC, Andre C, and Galibert F, 1999. Construction and optimization of a dog whole-genome radiation hybrid panel. Mamm Genome 10:888–894.[CrossRef][Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  T. Awano, G. S. Johnson, C. M. Wade, M. L. Katz, G. C. Johnson, J. F. Taylor, M. Perloski, T. Biagi, I. Baranowska, S. Long, et al. Genome-wide association analysis reveals a SOD1 mutation in canine degenerative myelopathy that resembles amyotrophic lateral sclerosis PNAS, February 24, 2009; 106(8): 2794 - 2799. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||