Journal of Heredity 2003:94(1)
© 2003 The American Genetic Association 94:69-73
MC1R Studies in Dogs With Melanistic Mask or Brindle Patterns
From the Department of Animal and Poultry Science, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5A8 (Schmutz and Berryere); Departments of Pediatrics and Genetics and the Howard Hughes Medical Institute, Stanford University School of Medicine, Stanford, CA (Kerns and Barsh); and Department of Pathobiology, University of Pennsylvania, Philadelphia, PA 19104 (Ellinwood).
Address correspondence to Sheila Schmutz at the address above, or e-mail: schmutz{at}sask.usask.ca.
| Abstract |
|---|
|
|
|---|
Black mask is a characteristic pattern in which red, yellow, tan, fawn, or brindle dogs exhibit a melanistic muzzle which may extend up onto the ears. Melanistic mask is inherited in several breeds as an autosomal dominant trait, and appears to be a fixed trait in a few breeds of dogs. A MC1R nonsense mutation, R306ter, has been shown to cause a completely red or yellow coat color in certain breeds such as Irish setters, yellow Labrador retrievers, and golden retrievers. The amino acid sequence for the melanocortin receptor 1 gene (MC1R) was examined in 17 dogs with melanistic masks from seven breeds, 19 dogs without melanistic masks, and 7 dogs in which their coat color made the mask difficult to distinguish. We also examined nine brindle dogs of four breeds, including three dogs who also had a black mask. No consistent amino acid change was observed in the brindle dogs. All dogs with a melanistic mask had at least one copy of a valine substitution for methionine at amino acid 264 (M264V) and none were homozygous for the premature stop codon (R306ter). These results suggest that black mask, but not brindle, is caused by a specific MC1R allele.
Coat color in dogs has been of interest to breeders since breed registries began. A few breeds of dogs have a brindle, tan, yellow, fawn, or other pale coat color of pheomelanin pigment over most of their body, but may have a black, brown, or gray mask over their muzzle (Figure 1). This black muzzle sometimes extends up over their ears. The pale coat color is thought to represent a specific pigment type, pheomelanin, chemically and ultrastructurally distinct from eumelanin, which is black, brown, or gray. Breeds that sometimes or always have such a black mask include the Akita, bullmastiff, boxer, German shepherd, Great Dane, greyhound, keeshond, Leonberger, mastiff, Pekingese, pug, Rhodesian ridgeback, sloughi, Tibetan spaniel, and whippet. Clarence C. Little, who pioneered the study of inheritance of coat colors and patterns in dogs in North America, proposed that a major determinant of pheomelanic coat color and the black mask was allelic variation at the Extension (E) locus, now known to represent the melanocortin 1 receptor (MC1R). Little (1957) proposed that dogs which were ee would produce pheomelanin coat colors such as yellow, gold, apricot, or red and that dogs which were black or brown always had one E allele. He further proposed that a dominant allele at the E locus, EM, was responsible for causing dogs to have a black mask and that a single copy of the allele ebr was responsible for the brindle pattern. Brindle is a pattern of alternating eumelanin and pheomelanin stripes in dogs which is obvious as stripes in short-haired breeds such as greyhounds, whippets, and Great Danes (Figure 1), but appears more as multicolored hairs on longhaired breeds such as Scottish deerhounds and Bouviers.
|
In other mammals, major determinants of the balance between eumelanin and pheomelanin synthesis are allelic variation at the MC1R locus and the Agouti locus. MC1R encodes a seven transmembrane-spanning receptor that, when active, causes hair follicle melanocytes to produce eumelanin instead of pheomelanin. Agouti protein is a paracrine signaling molecule secreted by specialized cells adjacent to hair follicle melanocytes that inhibits the MC1R. Thus MC1R loss of function or Agouti gain of function favors production of pheomelanin, while MC1R gain of function or Agouti loss of function favors production of eumelanin; in general, MC1R is epistatic to Agouti.
Newton et al. (2000) and Everts et al. (2000) described a premature stop codon, R306ter, in the dog melanocortin receptor 1 (MC1R) gene that was present in the homozygous state in dogs with red or yellow coat color, such as red Irish setters or yellow Labrador retrievers. This established that MC1R was indeed the same as the Extension locus, as has been shown to be the case in many other species such as cattle (Joerg et al. 1996; Klungland et al. 1995), horse (Marklund et al. 1996), and pig (Kijas et al. 1998). This work was extended by Schmutz et al. (2002) to demonstrate the interaction of these two MC1R alleles (E and e) with TYRP1 alleles, causing brown coat color and/or nose and pad color in dogs.
In this study we attempted to determine if an MC1R allele could be found which was associated with the black mask pattern or the brindle pattern. We therefore examined the DNA sequence of MC1R in several dogs of various breeds with black mask and/or brindle pattern.
| Materials and Methods |
|---|
|
|
|---|
Animals
DNA was obtained from several dogs, using cheek swab brushes (Epicentre, Madison, WI) or Cytobrush Plus GT cervical brushes (Medscand Medical, Malmö, Sweden). Coat color was recorded by the veterinarian and/or owner or by us if we took the sample. Nose color was also recorded in some cases. DNA samples from a litter of Great Dane pups which segregated for brindle were also obtained.
MC1R Sequencing
The primers D and E from Newton et al. (2000) were used to amplify the complete coding sequence. Genomic samples were sufficient since MC1R is composed of a single exon. Samples were prepared using the Concert Rapid PCR Purification System (GibcoBRL) and sequenced with an ABI sequencer at the Plant Biotechnology Institute in Saskatoon, Saskatchewan.
Genotyping
The V264M substitution causes an NlaIII restriction site to be formed with the Met allele. A new forward primer was designed to create a polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) test.
Forward: CGCTGCCACACTCACTATCCTGC
Reverse (primer G from Newton et al. 2000): CTGCCCAGCACCCTGGCCTC
Digestion with NlaIII produced a cut site in the allele containing A to produce a band of 194 and 76 bp.
The premature stop codon at amino acid 306 (Newton et al. 2000) or the e allele was detected using the reverse primer G and the purposeful mismatch primer designed for this purpose, CATCTACGCCTTCCGCAGCCAGGAGCGC (Schmutz et al. 2002), and digestion of the product with Eco47III. ZuBeCa6 (Ladon et al. 1998) was used to genotype the Great Dane family, since this microsatellite marker was linked to MC1R (Schmutz et al. 2001).
| Results |
|---|
|
|
|---|
The complete amino acid sequence was obtained from 11 dogs. In addition to the DNA variants previously reported by Newton et al. (2000), we detected an A to G transition in the first position of codon 264 which resulted in a methionine to valine change in several dogs with melanistic facial masks. A G to A transition in the first position of codon 205, which resulted in a valine to methionine change, was detected in a single dog. Variants reported previously (Newton et al. 2000) were also observed (not shown), but did not correlate with coat color phenotype.
We developed PCR-based tests for the M264V variant and the R306ter variant and genotyped a series of dogs. All 17 dogs with a melanistic mask were heterozygous or homozygous for V264 (Table 1). All 19 dogs that did not have black masks were homozygous for M264. Seven dogs presented phenotypes that were difficult to classify as to the presence or absence of a melanistic mask, although all were heterozygous or homozygous for V264 (Table 1). The latter class of exceptions (dogs without a black mask who carried V264) included two dogs (Shadow and Dodger) who probably lack melanocytes over most of their body, three dogs of uniform eumelanin colorationtwo toy poodles (brown or silver brown) and a black German shepherdin whom a eumelanin mask would not have been apparent, and two Scottish deerhounds, in whom gray brindling and longer hair obscured a mask pattern. Thus our results are consistent with the hypothesis that the M264V MC1R allele causes the melanistic mask trait.
|
We found no correlation between MC1R variation and the brindled phenotype (Table 1). We also had the opportunity to examine a litter of Great Dane pups in which brindle was segregating (Figure 2). Transmission of brindle in this pedigree is consistent with autosomal dominant inheritance, with the sire, Banjo, being heterozygous. The Great Dane male, Banjo, was found to be homozygous for the valine substitution at amino acid 264 from sequence. He was subsequently bred to a fawn female who also had a mask and all six of the pups had masks (Figure 2), as one would expect from a homozygote. However, only two of the six pups were brindle; confirming that mask and brindle segregate independently from each other. MC1R was mapped to dog chromosome 5 (Schmutz et al. 2001), about 6 cM from the microsatellite marker ZuBeCa6 (Ladon et al. 1998), using the A105T polymorphism. The Great Dane sire, Banjo, was not heterozygous for any other MC1R variant, therefore his family was genotyped using ZuBeCa6. Allele sizes (Figure 2) show that all of the offspring, two brindle and four nonbrindle, inherited the same paternal ZuBeCa6 allele, which suggests that MC1R variation is not responsible for brindling in this pedigree.
|
| Discussion |
|---|
|
|
|---|
All dogs who had a black mask had a valine instead of a methionine at amino acid 264 of MC1R. However, not all dogs with this substitution had a black mask. Dogs which are black, such as Sinder (Table 1), cannot show a black mask. Furthermore, dogs which have two "brown" mutations at TYRP1 would produce brown instead of black eumelanin pigment (Schmutz et al. 2002). Brown dogs, such as the toy poodles Flutey and Lacey, would not show a brown mask on a brown body, as discussed by Willis (1989). Likewise the Rhodesian ridgeback (CJ), which had a brown nose, would have a brown mask that could not be easily distinguished from the red body color. Sometimes masks are also difficult to detect on brindle dogs, since the dark stripes and the width of the stripes vary considerably. Furthermore, in some breeds such as greyhounds, where brindle is often diluted to pale gray stripes on pale yellow, or Scottish deerhounds, which are now all gray brindle, the black mask becomes gray or almost white, as it did in Doink. The pigmentation in the mask responds to other genes affecting the type of eumelanin produced and is therefore a melanistic mask, but not necessarily a black mask.
MC1R variation has been shown to affect hair color variation in a large number of vertebrate species. In most cases, loss-of-function mutations cause a uniform pale and/or pheomelanic coloration, as in humans with carrot-red hair and fair skin (Valverde et al. 1995), yellow Labrador retrievers (Everts et al. 2000; Newton et al. 2000), or very pale Kermode bears, while gain-of-function mutations that encode a constitutively active receptor cause a uniform eumelanic coloration, as in black sheep (V
ge et al. 1999), black pigs (Kijas et al. 1998), or dark jaguarundis (Eizirik et al. in press). Coat color phenotypes which show a mixture of pheomelanin and eumelanin in different regions of the body are generally caused by regional expression of Agouti or genetically unstable MC1R alleles associated with somatic mosaicism. However, an exception is the fox, in which the combination of a dominant Agouti allele and a constitutively active MC1R cause a mixture of pheomelanin and eumelanin in a patterned distribution (V
ge et al. 1997).
In dogs, Little (1957) suggested that the presence of a black mask on an otherwise pheomelanic coat was caused by an MC1R allele (known then as Extension [EM]), while Winge (1950), another authority on genetics of dog coat color, suggested that black mask was caused by an Agouti allele (Winge used the terminology cma). Although the dog Agouti gene has not yet been characterized, our results are consistent with Little's suggestion, since we observed an association between a specific MC1R allele, M264V, and the black mask phenotype. Including black mask and MC1R loss of function (e) in the same allelic series also implies that the two sequence variants, M264V and R306ter, should never be found in cis. Finally, because pheomelanic coat color in breeds with black masks is presumably caused by a gain-of-function Agouti allele (described historically as ay or at), red, yellow, or pale animals in these breeds should never be homozygous for R306ter. Both predictions are consistent with our results. Black mask is considered a fixed trait in certain breeds, such as boxers, bullmastiffs, and pugs. Even the white boxer, Shadow, was homozygous for valine at residue 264, although he was unable to produce pigment anywhere and therefore no mask was visible. Our results are unlikely to be explained by chance fixation of an M264V polymorphism, since the association is apparent within greyhounds. Nonetheless, the substitution does not predict an obvious effect on receptor function, and additional pedigree and/or pharmacologic data will be needed to prove convincingly that M264V causes black mask.
Based on biochemical and genetic studies in the mouse, we anticipate that an MC1R allele responsible for black mask should increase receptor activity. The predicted location of residue 264 lies at the junction of the sixth transmembrane domain and the third exoloop, and it is possible that M264V could inhibit binding or action of Agouti protein, increase the ability of the receptor to couple to adenylate cyclase, or increase the amount of receptor protein at the cell surface. It is also possible that M264V is in linkage disequilibrium with a noncoding sequence variant that causes an increase in steady-state mRNA levels. However, the same amino acid change occurred in dog breeds as evolutionarily divergent as the Akita and the greyhound, which would suggest that this polymorphism had to be very old and remained in linkage disequilibrium with the causative mutation over hundreds of generations.
Regardless of these considerations, a specific MC1R allele that causes localized distribution of eumelanin in an otherwise pheomelanic animal is unlikely to be explained by a mutation that causes regional differences in receptor expression, and instead implies the existence of an underlying pattern that affects melanocortin receptor signaling in certain regions of the body. For example, the same developmental mechanisms responsible for regional differences in hair type and hair length (i.e., beards in wirehaired breeds) could also affect the number of melanocytes per hair follicle or the ratio of hair follicle melanocytes to mesenchymal cells that secrete Agouti protein. Thus specific regions of the body might have different thresholds for the switch between eumelanin and pheomelanin synthesis, and germline variation of the MC1R sequence might affect the threshold in some but not other regions.
In addition to black mask, Little (1957) also postulated that brindle was part of the Extension series (ebr), although Winge put brindle in the Agouti series. Our results suggest that brindling is not caused by MC1R variation, since there was no consistent MC1R sequence variant among seven brindle dogs. Three of the brindle dogs were homozygous for M264V, two dogs were heterozygous for A105T, and three dogs were heterozygous (one) or homozygous (two) for P159Q. The latter two variants were present in several dogs genotyped by Newton et al. (2000), none of which were brindle. Most important, in a pedigree where brindle was segregating as a dominant, brindle and nonbrindle animals inherited the same MC1R allele from their brindle parent.
| Acknowledgments |
|---|
We appreciate the cooperation of the dog owners who allowed us to take DNA samples from their dogs. We thank the Natural Science and Engineering Research Council of Canada for funding and acknowledge support from the National Institutes of Health (grant RR007063 to N.M.E.). This paper was delivered at the Advanced Canine and Feline Genomics symposium, St. Louis, MO, May 1619, 2002.
| Footnotes |
|---|
Corresponding Editor: Stephen J. O'Brien
| References |
|---|
|
|
|---|
-
Eizirik E, Yuhki N, Johnson WE, Menotti-Raymond M, Hannah S, O'Brien SJ, in press. Molecular genetics and evolution of melanism in the cat family. Curr Biol.
Everts RE, Rothuizen J, van Oost BA, 2000. Identification of a premature stop codon in the melanocyte-stimulating hormone receptor gene (MC1R) in Labrador and golden retrievers with yellow coat colour. Anim Genet. 31:194-199.[CrossRef][Web of Science][Medline]
Joerg H, Fries R, Meijerink E, Stranzinger GF, 1996. Red coat color in Holstein cattle is associated with a deletion in the MSHR gene. Mamm Genome. 7:317-318.[CrossRef][Web of Science][Medline]
Kijas J, Wales R, Törnsten A, Chardon P, Moller M, Andersson L, 1998. Melanocortin receptor 1 (MC1R) mutations and coat color in pigs. Genetics. 150:1177-1185.
Klungland H, Våge DI, Gomez-Raya L, Adalsteinsson S, Lien S, 1995. The role of melanocyte-stimulating hormone (MSH) receptor in bovine coat color determination. Mamm Genome. 6:636-639.[CrossRef][Web of Science][Medline]
Ladon D, Schelling C, Dolf G, Switonski M, Schläpfer J, 1998. The highly polymorphic canine microsatellite ZuBeCa6 is localized on canine chromosome 5q12-q13. Anim Genet. 29:466-467.[Medline]
Little CC, 1957. The inheritance of coat color in dogs. New York: Howell Book House.
Marklund L, Johansson Moller M, Sandberg K, Andersson L, 1996. A missense mutation in the gene for melanocyte stimulating hormone receptor (MC1R) is associated with the chestnut color in horses. Mamm Genome. 7:895-899.[CrossRef][Web of Science][Medline]
Newton J, Wilkie A, He L, Jordan S, Metallinos D, Holmes N, Jackson IJ, Barsh G, 2000. Melanocortin 1 receptor variation in the domestic dog. Mamm Genome. 11:24-30.[CrossRef][Web of Science][Medline]
Ritland K, Newton C, Marshall HD, 2001. Inheritance and population structure of the white-phased "Kermode" black bear. Curr Biol. 11:1468-1472.[CrossRef][Web of Science][Medline]
Schmutz SM, Berryere TG, Goldfinch AD, 2002. TYRP1 and MC1r genotypes and their effects on coat color in dogs. Mamm Genome. 13:380-387.[CrossRef][Web of Science][Medline]
Schmutz SM, Moker JS, Berryere TG, Christison KM, 2001. A SNP is used to map MC1r on dog chromosome 5. Anim Genet. 32:43-44.[Medline]
Våge DI, Klungland H, Lu D, Cone R, 1999. Molecular and pharmacological characterization of dominant black coat color in sheep. Mamm Genome. 10:39-43.[CrossRef][Web of Science][Medline]
Våge DI, Lu D, Klungland H, Lien S, Adalsteinsson S, Cone RD, 1997. A non-epistatic interaction of agouti and extension in the fox, Vulpes vulpes. Nat Genet. 15:311-315.[CrossRef][Web of Science][Medline]
Valverde P, Healey E, Jackson I, Reiss JL, Thody AJ, 1995. Variants of the melanocyte-stimulating hormone receptor gene are associated with red hair and fair skin in humans. Nat Genet. 11:328-330.[CrossRef][Web of Science][Medline]
Willis MB, 1989. Genetics of the dog. New York: Howell Book House.
Winge O, 1950. Inheritance in dogs with special reference to the hunting breeds. Ithaca, NY: Comstock.
This article has been cited by other articles:
![]() |
S. M. Schmutz and T. G. Berryere The Genetics of Cream Coat Color in Dogs J. Hered., August 3, 2007; (2007) esm018v3. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Kerns, E. J. Cargill, L. A. Clark, S. I. Candille, T. G. Berryere, M. Olivier, G. Lust, R. J. Todhunter, S. M. Schmutz, K. E. Murphy, et al. Linkage and Segregation Analysis of Black and Brindle Coat Color in Domestic Dogs Genetics, July 1, 2007; 176(3): 1679 - 1689. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. E. van Hagen, J. van der Kolk, M. A. M. Barendse, S. Imholz, P. A. J. Leegwater, B. W. Knol, and B. A. van Oost Analysis of the Inheritance of White Spotting and the Evaluation of KIT and EDNRB as Spotting Loci in Dutch Boxer Dogs J. Hered., November 1, 2004; 95(6): 526 - 531. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



