Journal of Heredity 2003:94(5)
© 2003 The American Genetic Association 94:416-420
Brief Communication |
Genetic and Molecular Markers of the Queensland Fruit Fly, Bactrocera tryoni
From the Fruit Fly Research Centre, School of Biological Sciences, A12, University of Sydney, NSW 2006, Australia.
Address correspondence to Dr. Gillies at the address above, or e-mail: cgillies{at}bio.usyd.edu.au.
| Abstract |
|---|
|
|
|---|
Twenty-six microsatellite markers, along with two restriction fragment length polymorphism (RFLP) markers and three morphological markers, have been mapped to five linkage groups, corresponding to the five autosomes of the Queensland fruit fly, Bactrocera tryoni. All these molecular and genetic markers were genotyped in three-generation pedigrees. Eight molecular markers were also localized to the salivary gland polytene chromosomes by in situ hybridization. This provides a substantial starting point for an integrated genetic and physical map of B. tryoni.
The Queensland fruit fly, Bactrocera tryoni (Diptera, Tephritidae), is a significant pest of Australia's east coast orchards, infesting almost every commercial fruit crop except pineapple and strawberry (Drew 1989). The general approach of biological control through the sterile insect technique (SIT) has been applied to minimize the use of chemical insecticides. It has been shown that release of sterile male flies in place of sterile mixed broods can improve the SIT program considerably (McInnis et al. 1994). In the Mediterranean fruit fly, Ceratitis capitata, Y-autosome translocations with recessive markers have been used to construct genetic sex-separation strains (e.g., Franz et al. 1996; Robinson and Heemert 1982). Similar Y-autosome translocations have also been constructed in B. tryoni (Meats et al. 2002). This work will be facilitated by the establishment of a combined genetic and physical map.
In the last decade, new classes of genetic markers, such as microsatellites and restriction fragment length polymorphisms (RFLPs), were found to be ideal for linkage analysis and boosted the generation of genetic maps in insect species. In the malaria mosquito, Anopheles gambiae, a detailed microsatellite genetic map has been constructed (Zheng et al. 1996) and used to identify and localize two genetic loci that are involved in refractoriness of A. gambiae to Plasmodium (Zheng 1997). A good recombination map, based on RFLP analysis, has been established for the yellow fever mosquito, Aedes aegypti (Severson et al. 1993), and has greatly facilitated the analysis of complex traits such as refractoriness to filarial and plasmodial parasites (Severson et al. 1994, 1995). In B. tryoni, 16 microsatellite markers were isolated and shown to be polymorphic in five widely separated population samples (Kinnear et al. 1998). Among these markers, six highly polymorphic loci were used in a study to reveal the population structure of B. tryoni in Australia (Yu et al. 2001).
In this paper, we report the establishment of five linkage groups of B. tryoni, including 26 microsatellite markers, three visible markers, and two RFLP markers. All the linkage groups have been assigned to the polytene chromosomes by in situ hybridization of selected microsatellite sequences and cloned genes.
| Materials and Methods |
|---|
|
|
|---|
Fly Stocks
The wild-type laboratory stock of B. tryoni originated from the Post-Harvest Laboratory in Gosford, New South Wales, Australia, where it had been the domestic stock for almost 20 years. In the Post-Harvest Laboratory, occasional wild flies collected from the surrounding orchards had been introduced into the stock, under uncontrolled conditions, without any forced mating. It is unclear how many, if any, fresh wild characters were present in the stock. Therefore, it was taken to represent a laboratory-adapted stock with wild-type phenotype. The stock was introduced to the Fruit Fly Research Centre in 1991 and has been maintained since then for at least 50 generations. During 19961997, in order to provide the laboratory stock with more fresh wild character, wild flies collected from the Sydney area were occasionally introduced into the stock by forced mating. Flies were reared at 25°C with 70% relative humidity and a 14 h light/10 h dark cycle. Adults were fed on a mixture of sucrose and yeast (Bateman 1967). To provide larval polytene-chromosome materials for in situ hybridization, larvae were grown at 25°C in uncrowded, well-yeasted carrot medium (Bateman 1967) containing 4.8% protein and 11.7% dry carrot powder (H. J. Landgon & Company P/L).
Three recessive markers, orange eyes (oe), white marks (wm), and bent wings (bw) (Meats et al. 2002) were used in the mapping experiment. Each of these markers was identified initially through inbreeding from the Gosford and other wild-type stocks. Penetrance is incomplete at low temperatures for the bw mutation. Recombination frequencies for this marker were therefore restricted to progeny scored as mutant rather than wild type.
Genetic Crosses
Homozygous lines have not been established for any of the microsatellite markers. The variety of different markers would make this an extremely difficult task. However, the high variability of the microsatellites allowed us to set up informative crosses that could be scored, in retrospect, for segregation of all markers.
Crosses were made involving the three genetically marked stocks, oe, wm, and bw. In each case a single female was crossed to a single male from the wild-type stock. Then a single F1 male or a single F1 female was backcrossed to a single fly from the same genetically marked stock. This procedure assures segregation for the visible marker, and optimizes the chance of producing a segregating backcross for microsatellite markers. Because of the expected absence of male recombination, crosses involving F1 males serve to assign markers to chromosomes, while those involving F1 females provide mapping data. Figure 1 shows the actual crosses and markers.
|
Most of the information on markers from the two most densely marked chromosomes comes from crosses involving three or more linked markers. Ordering was facilitated in such crosses by testing the distribution of crossovers implied for all possible marker orders on the chromosome. For example, for the case of cross wm-3 chromosome 2, a computer program was written to test each of the 2,520 (= 7!/2) possible orders of markers. For each order, the distribution of crossover points required to explain each progeny was calculated, and the ten marker orders having the lowest total number of crossovers were printed out. We then chose the order that implies the most realistic crossover distribution. In the case of cross wm-3 for markers on chromosome 2, the chosen order is consistent with a maximum of three crossovers over the chromosome.
Molecular Markers
Microsatellites were identified from screenings of two partial genomic libraries, as described in Kinnear et al. (1998) and Wang et al. (2003). Nine microsatellites were chosen from the first B. tryoni genomic library screening, based on the initial estimates of polymorphism of the markers (Kinnear et al. 1998, Table 1) and the insert size of the clones. Among these nine microsatellites, six were described in Table 1 of Yu et al. (2001), and the other three were loci 9.4.8, 12.8.1A, and 1.7.7 in Table 1 of Kinnear et al. (1998), redesignated as Bt5, Bt4, and Bt6, respectively. Nineteen microsatellites were chosen from the second library screening. The microsatellite structures, primers, and alleles are described in Table 1 of Wang et al. (2003).
Microsatellites Bt14 and Bt4 were recovered from the same clone 12.8.1, and microsatellites 2.6A and 2.6B were also recovered from a single clone. PCR on genomic DNA using primers that spanned both microsatellites in each clone excluded the possibility that the recovery of the two markers from the same clone was an artifact of the cloning procedures. In total, therefore, the 28 microsatellite markers correspond to 26 loci.
In B. tryoni, restriction assays of genomic PCR products within exons 46 of the B. tryoni white eye-color gene (Bennett and Frommer 1997) revealed polymorphism at RsaI restriction sites within intron 5. This RFLP marker is designated as Rwhite. Also, PCR and subsequent restriction digestion on another B. tryoni eye-color gene, scarlet (Zhao et al., 2003), revealed one BclI polymorphic site within exon 5, and this RFLP marker is designated as Rscarlet.
PCR primers for Rwhite, 5'-3', are: GAGGACGAGAATGGATTTACA and TGGTATGATAACAGGTGGGC; PCR primers for Rscarlet, 5'-3', are: AGACGGGTGACTATCCCTTC and GCATATAACATCCATGACAG.
Genotype Analysis
Microsatellite typing was performed as detailed by Yu et al. (2001).
The specific oligonucleotide primers for RFLP typing of the Rwhite and Rscarlet markers were synthesised by Geneworks. The 25 µl PCR reactions included 1x Tth plus buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.6 µM each primer, 0.66 U Tth plus DNA polymerase (Biotech International), and 3 µl of a Chelex DNA supernatant. Cycle program: 94°C for 3 min; 30 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min; and 1 cycle of 72°C for 5 min. The PCR product (10 µl) was digested with restriction enzymes and size separated by 2% agarose gel electrophoresis.
Polytene Chromosome In Situ Hybridization
Genomic clones containing microsatellite repeats (Kinnear et al. 1998, Table 1), labeled with biotin-16-dUTP (Roche) using the random priming method, were used as probes in polytene chromosome in situ hybridization experiments, as described by Zhao et al. (1998).
| Results and Discussion |
|---|
|
|
|---|
In total, 13 three-generation pedigrees, each marked with the mutation oe, wm, or bw, were generated in the experiment and have been used to map the morphological and molecular markers (Figure 1). Genotyping of molecular markers was performed on the mapping panel, composed of each three-generation family of B. tryoni: a pair of G0, a pair of F1, and various numbers of F2 progeny (12113 from each of the families, Figure 1). A total of 26 microsatellite markers and two RFLP markers were genotyped in 13 backcross families that included 619 progeny. (Complete data are available on request.) Alleles were identified on the basis of their electrophoretic mobility. The PCR products appeared as single (homozygote) or double (heterozygote) bands. All alleles behaved as autosomal codominant Mendelian factors. No evidence of mutations occurring during the crosses was seen.
Using the in situ hybridization technique, the 1.1-kb microsatellite fragment Bt32 maps to a unique site on chromosome 2, section 4B. The hybridization signal was located on a puff; thus it showed a characteristic dispersed granular appearance. The purified 806-bp insert of microsatellite clone 12.8.1 (microsatellite markers Bt4 and Bt14) hybridized to section 5C on chromosome 2. The microsatellite clones Bt5 and Bt17 were definitively located on chromosome 3, section 23B and chromosome 4, section 59B, respectively. The microsatellite clones Bt15 and Bt10 were both mapped to section 99B of chromosome 6 on two bands next to each other. Because the B. tryoni white gene has been located on chromosome 5, section 71B, by polytene chromosome in situ hybridization (Zhao et al. 1998), the linkage group containing the RFLP marker Rwhite has been assigned to chromosome 5. The B. tryoni scarlet gene has been located on chromosome 6, section 82A (Zhao et al. 1998); the scarlet RFLP marker is located at that position. No recombination was found between the oe phenotype and the Rscarlet marker in the oe-4 family, indicating that the oe locus and the scarlet gene are very closely linked, estimated within one map unit.
Based on the above data, five linkage groups were unambiguously defined, corresponding to the five autosomes previously identified cytologically (Zhao et al. 1998). No markers were found corresponding to the largely heterochromatic X and Y chromosomes. The most likely genetic map is shown in Figure 2.
|
In the B. tryoni genotyping process, no genetic recombination between the syntenic loci was found in F1 males. This result conforms to the general rule that crossing over is rare or absent in males of higher Diptera (e.g., Cladera 1981; Foster and Whitten 1974; Morgan 1914). The absence of crossing over in B. tryoni males allows linkage to be demonstrated from a male backcross with a small number of progeny, which overcomes the difficulty in obtaining large numbers of progeny in single-pair crosses, and also makes the construction of genetic maps in B. tryoni easier and faster. Nevertheless, crossing over in males has been found with a low frequency in several species of higher Diptera (Foster et al. 1980; Rössler 1982a,b) and cannot be excluded entirely in B. tryoni.
In situ hybridization of unique sequences of microsatellite markers to polytene chromosomes allows the genetic and polytene maps to be aligned with respect to each other. Some of the microsatellites included in this linkage analysis are also variable in other species of the genus Bactrocera (Shearman DCA, personal communication). Thus, they can provide a cross reference to establish linkage groups in pest species for which few markers are available.
| Acknowledgments |
|---|
This work was supported by grants from Woolworths Supermarkets and the Horticultural Research & Development Corporation.
| Footnotes |
|---|
Corresponding Editor: R. C. Woodruff
Received January 10, 2003
Accepted May 30, 2003
| References |
|---|
|
|
|---|
-
Bateman MA, 1967. Adaptations to temperature in geographic races of the Queensland fruit fly, Dacus (Strumeta) tryoni. Aust J Zool. 15:1141-1161.[CrossRef]
Frommer M, Bennett CL, 1997. The white gene of the tephritid fly Bactrocera tryoni is characterized by a long untranslated 5' leader and a 12 kb first intron. Insect Mol Biol. 6:343-356.[CrossRef][Web of Science][Medline]
Cladera JL, 1981. Absence of recombination in the male of Ceratitis capitata. Experientia. 37:342-343.[CrossRef][Web of Science][Medline]
Drew RAI, 1989. The tropical fruit flies (Diptera: Tephritidae: Dacinae) of the Australasian and Oceanian regions. Mem Qld Mus. 26:1-521.
Mills AT, Maddern RH, Foster GG, 1980. Genetic instability in mass-rearing colonies of a sex-linked translocation strain of Lucilia cuprina (Wiedemann) (Diptera: Calliphoridae) during a field trial of genetic control. Theor Appl Genet. 58:169-175.
Whitten MJ, Foster GG, 1974. The development of genetic methods of controlling the Australian sheep blowfly, Lucilia cuprina. In: The use of genetics in insect control, (Pal R and Whitten MJ, eds). Amsterdam: Elsevier; 1943.
Hendrichs J, Rendon P, Kerremans P, Franz G, 1996. Development and application of genetic sexing systems for the Mediterranean fruit fly based on a temperature sensitive lethal. In: Fruit fly pests, a world assessment of their biology and management (McPheron BA and Steck G, eds). Delray Beach, Florida: St. Lucie Press; 185191.
Frommer M, Sved JA, Bariana HS, Kinnear MW, 1998. Polymorphic microsatellite markers for population analysis of a tephritid pest species, Bactrocera tryoni. Mol Ecol. 7:1489-1495.[CrossRef][Medline]
Miyashita D, Grace C, Tam SYT, McInnis DO, 1994. Population suppression and sterility rates induced by variable sex ratio, sterile insect releases of Ceratitis capitata (Diptera: Tepheritidae) in Hawaii. Ann Entomol Soc Am. 87:231-240.
Sved J, Frommer M, Maheswaran P, Meats A, 2002. Towards a male-only release system for SIT with the Queensland fruit fly Bactrocera tryoni, using a genetic sexing strain with a temperature-sensitive lethal mutation. Genetica. 116:97-106.[CrossRef][Web of Science][Medline]
Morgan TH, 1914. Crossing over in males of Drosophila genus in the second and third pairs of chromosomes. Biol Bull. 26:195-204.
Van Heemert C, Robinson AS, 1982. Ceratitis capitataa suitable case for genetic sexing. Genetica. 58:229-237.[CrossRef]
Rössler Y, 1982a. Genetic recombination in males of the Mediterranean fruit fly, and its relation to automated sexing methods. Ann Entomol Soc Am. 75:28-31.
Rössler Y, 1982b. Recombination in males and females of the Mediterranean fruit fly (Diptera: Tephritidae) with and without chromosomal aberrations. Ann Entomol Soc Am. 75:619-622.
Christensen BM, Zhang Y, Mori A, Severson DW, 1993. Linkage map for Aedes aegypti using restriction fragment length polymorphisms. J Hered. 84:241-247.
Christensen BM, Zhang Y, Mori A, Severson DW, 1994. Chromosomal mapping of two loci affecting filarial worm susceptibility in Aedes aegypti. Insect Mol Biol. 3:67-72.[Medline]
Christensen BM, Zhang Y, Mori A, Tahathy V, Severson DW, 1995. Restriction fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the mosquito Aedes aegypti. Genetics. 139:1711-1717.[Abstract]
Gilchrist AS, Raphael K, Yu H, Wang Y, 2003. Genetic delineation of sibling species of the pest fruit fly Bactrocera (Diptera: Tephritidae) in Australia using microsatellites. Bull Entomol Res. 93:351-360.[CrossRef][Web of Science][Medline]
Sved JA, Shearman DCA, Meats AW, Robson MK, Frommer M, Yu H, 2001. Microsatellite analysis of the Queensland fruit fly Bactrocera tryoni (Diptera: Tephritidae) indicates spatial structuring: implications for population control. Bull Entomol Res. 91:139-147.[Web of Science][Medline]
Raphael KA, Frommer M, Stewart GJ, Bennett CL, Zhao JT, 2003. The scarlet eye colour gene of the tephritid fruit fly Bactrocera tryoni and the nature of two eye colour mutations. Insect Mol Biol. 12:263-269.[CrossRef][Web of Science][Medline]
Zacharopoulou A, Sved JA, Frommer M, Zhao JT, 1998. Mitotic and polytene chromosome analyses in the Queensland fruit fly, Bactrocera tryoni (Diptera: Tephritidae). Genome. 41:510-526.[Medline]
Zheng LB, 1997. Molecular approaches to mosquito parasite interactions. Arch Insect Biochem Physio. 34:1-18.
Kafatos FC, Collins FH, Cornel AJ, Benedict MQ, Zheng L, 1996. An integrated genetic map of the African human malaria vector mosquito, Anopheles gambiae. Genetics. 143:941-952.[Abstract]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

) indicates that, because of incomplete penetrance of the bw mutation at the temperatures studied, only markers definitely scored as having the bent wings phenotype, about half the number shown, were used for linkage calculations involving bw.