Journal of Heredity Advance Access originally published online on November 2, 2005
Journal of Heredity 2005 96(7):829-835; doi:10.1093/jhered/esi126
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Canine DNA Subjected to Whole Genome Amplification is Suitable for a Wide Range of Molecular Applications
From the Centre for Integrated Genomic Medical Research, Stopford Building, University of Manchester, Manchester, UK (Short, Kennedy, Thomson, and Ollier); Mammalian Immunogenetics Research Group, Veterinary Clinical Sciences, University of Liverpool, Liverpool, UK (Barnes); Waltham Centre for Pet Nutrition, Freeby Lane, Leicestershire, UK (Fretwell and Wiggall); and Animal Health Trust, Newmarket, Suffolk, UK (Forman)
Address correspondence to Andrea D. Short at the address above, or e-mail: andrea.short{at}manchester.ac.uk.
| Abstract |
|---|
|
|
|---|
Molecular and genetic studies of canine disease phenotypes can be limited by the amount of DNA available for analysis. New methods have been developed to amplify the genomic DNA of a species producing large quantities of DNA from small starting amounts. Whole genome amplification (WGA) of DNA is now being used in human studies, although this technique has not been applied extensively in veterinary research. We evaluated WGA of canine DNA for suitability in a range of molecular tests. DNA from 93 canine blood extracted and 18 buccal swab samples was subjected to WGA using the GenomiPhi kit (Amersham). Genomic DNA was compared with WGA product using a range of techniques, including reference strand-mediated conformation analysis, denaturing high-performance liquid chromatography analysis, microsatellite genotyping, direct DNA sequencing, and single nucleotide polymorphism allelic discrimination. All samples amplified well, giving an average yield of 3 µg of DNA from 2.5 ng of starting material. Extremely high levels of experimental reproducibility and concordance were observed between source and WGA DNA samples for all analyses used: greater than 95% for blood extracted DNA and greater than 80% for buccal swab DNA. These studies clearly demonstrate the usefulness of WGA of canine DNA as a means of increasing DNA quantities for canine studies. This technique will have major implications for future veterinary research.
The canine genome has been fully sequenced and is now publicly accessible. Studies using this information can be restricted by the amount of available DNA for research. The volume of blood available for DNA-based studies is usually limited, due to the fact that sample collection for research purposes in the United Kingdom requires Home Office approval, except when residual to that collected for clinical investigations. Furthermore, once samples have been depleted, recollection is usually impossible. DNA can be extracted from buccal swabs, a method that simplifies such issues, but small quantities of DNA are obtained and sample analysis remains limited. Inadequate samples of DNA often result in small study numbers for genetic research, reducing statistical power to detect specific effects.
Limited amounts of human DNA for study have been overcome through whole genome amplification (WGA). This is a technique whereby the entire genome is replicated, generating micrograms of DNA from starting amounts of a few nanograms. A number of WGA methods are available, many of which have been extensively studied using human genomic DNA (gDNA) as template. These methods fall into two categories: polymerase chain reaction (PCR)-based and multiple displacement amplification (MDA).
Polymerase chain reaction-based amplification methods are more numerous and include primer extension preamplification (PEP), improved primer extension preamplification (iPEP), and degenerate oligonucleotide-primed PCR (DOP). They are reported to be less accurate, less reproducible, and often show significant amplification bias (Dean et al. 2002) or allele dropout (Kittler et al. 2002; Wells et al. 1999). While amplified DNA exhibits some bias, it can be used for most genotyping methods; however, because these methods are PCR based, amplified products are short (usually less than 12 kb) and may not be suitable for all molecular applications.
The MDA method of WGA overcomes this problem by displacing one DNA strand while simultaneously amplifying another. This is a simple isothermal reaction carried out using
29 bacteriophage DNA polymerase. This enzyme, isolated from Bacillus subtilis, consists of a single polypeptide that is able to catalyze the formation of the initiation process, and has 3'
5' exonuclease activity (Blanco et al. 1989). Due to the unique action of this enzyme, the resultant products are large, ranging from 12 kb to an estimated 100 kb, and are highly accurate due its proofreading ability and low error rate (Lasken and Egholm 2003).
Multiple displacement amplification WGA has been used to amplify human DNA from many sources, including blood (Dean et al. 2002), cell lines (Barker et al. 2004), buffy coat (Hosono et al. 2003), buccal swabs (Hosono et al. 2003), and residual cells (Sorensen et al. 2004). In all cases, WGA has been shown to be unbiased for human gDNA amplification with the exception of the centromere and telomere, which experience some loss of amplification (Dean et al. 2002), and long and short interspersed nuclear elements (LINEs and SINEs), which exhibit 74% and 71% representation in comparison to unamplified DNA, respectively (Hosono et al. 2003). WGA of human DNA has been used in a number of molecular analyses and has been shown to give highly concordant results when compared to unamplified DNA (Cargill et al. 2002; Gorrochotegui-Escalante and Black 2003; Mai et al. 2004).
Successful WGA of canine DNA would dramatically increase the availability of DNA for high-throughput analysis and stimulate rapid advancement of canine disease research. It is therefore critical that WGA of canine DNA be thoroughly evaluated as being a suitable method for providing good quality DNA. We have assessed one such method for WGA of canine DNA and have determined its usefulness in a range of molecular applications.
| Materials and Methods |
|---|
|
|
|---|
DNA was extracted from residual ethylenediaminetetraacetic acid (EDTA) blood samples from 93 dogs of various breeds using a standard phenol:chloroform method. These were normalized to 50 ng/µl. In addition, 18 buccal swab DNAs were extracted using QIAmp spin columns and diluted to 2.5 ng/µl. DNA samples were amplified using the GenomiPhi kit (Amersham, Buckinghamshire, UK). For each sample, 1 µl of DNA at 2.5 ng/µl was added to 9 µl of sample buffer. A WGA-positive control (1 µl
-DNA at 10 ng/µl) and a negative control (1 µl Milli-Q 18 M
water) were also included. Samples were heated to 95°C for 3 min then immediately cooled on ice. A master mix of Phi enzyme and reaction buffer was prepared (1:9, respectively), vortexed, and 10 µl were added per sample. The reactions were vortexed and centrifuged briefly, being kept on ice in between. Samples were amplified at 30°C for 17 h, heat denatured at 65°C for 10 min and 95°C for 3 min, then kept at 4°C until being stored at 20°C. Following amplification, 1 µl of sample was run on a 2% agarose gel containing 0.5 µg/ml ethidium bromide to check the quality of the DNA. Whole genome amplification DNA concentration was measured using Picogreen. The average yield per sample was 3 µg. All samples were diluted to a final concentration of 5 ng/µl.
Eight sets of canine oligonucleotide primers were optimized using a PTC-225 MJ Tetrad gradient cycler (Table 1). For denaturing high-performance liquid chromatography (DHPLC) WAVE screening, PCRs were performed in 25 µl volumes containing 25 pmol forward and reverse primer, 1x Qiagen buffer (10x stock containing 15 mM MgCl2) (Qiagen, Venlo, The Netherlands), 0.5 U Qiagen HotStarTaq, 0.8 mM dNTP, 25 ng DNA, and deionized water. Positive and negative control reactions were included.
|
Denaturing high-performance liquid chromatography was carried out on WAVE DNA fragment analysis equipment (Transgenomic, Inc., Omaha, NE). PCR products were screened for heteroduplexes by subjecting a 25 µl reaction to a denaturation step (95°C for 5 min) and then a gradual annealing gradient of 1°C/1.5 min down to a final temperature of 4°C. Five microliters of the PCR product were separated through a 2% linear acetonitrile gradient. Temperatures for optimal heteroduplex separation were determined using WaveMaker software (Transgenomic, Inc.). Each PCR product was analyzed at two different temperatures to allow detection of polymorphisms along the entire fragment. PCR products were analyzed using partial denaturing conditions. A low-range mutation standard was included in each run to verify column resolution. Sample patterns were analyzed using WaveMaker software. Different pattern types were given sequential numbers until all samples were assigned. For each pattern, one PCR product was selected for DNA sequencing.
Prior to DNA sequencing, PCR products were treated using 2 U shrimp alkaline phosphatase (SAP) (Amersham) and 10 U ExoI (NEB) per 5 µl product. Products and primers were sent to Lark Technologies, Inc. (Saffron Walden, UK). Samples were sequenced in both forward and reverse orientation. Sequence traces were analyzed using Chromas (version 1.45) and aligned using the Genebee multiple alignment tool (http://www.genebee.msu.su/index.html).
To compare single nucleotide polymorphism (SNP) genotyping of WGA and source DNA, 17 confirmed canine SNPs were selected for analysis. For each, a 400 bp region of sequence was submitted to Applied Biosystems with the SNP central, for the SNP nonhuman assay by design service. Test reactions contained 2.5 µl 2x master mix without UNG (Eurogentec, Seraing, Belgium), 0.125 µl 40x assay mix, 0.375 µl Milli-Q water, and 2 µl DNA at 5 ng/µl. Standard PCR amplification conditions were used: 2 min at 50°C, 10 min at 95°C, 40 cycles of 15 s at 95°C, and 1 min at 60°C. Samples were stored at 4°C in the dark until being read on an ABI Prism 7700 (Applied Biosystems).
The suitability of WGA for reference strand-mediated conformation analysis was assessed as follows. Primers for the amplification of exon 2 of canine DLA-DRB1, DQA1, and DQB1 were selected (Kennedy LJ, unpublished data; Wagner et al. 1996). All locus-specific primers were intronic: DRBF, GATCCCCCCGTCCCCACAG; DRBR3, CGCCCGCTGCGCTCA; DQAin1, TAAGGTTCTTTTCTCCCTCT; DQAIn2, GGACAGATTCAGTGAAGAGA; DQB1B, TAAGGTTCTTTTCTCCCTCT; DQBR2, CACCTCGCTGCAACGTG. PCRs were performed with 25 ng DNA in a 25 µl reaction containing 1x PCR buffer, Q solution (Qiagen), final concentrations of 0.1 µM for each primer, 200 µM each dNTP, with 2 U of Qiagen HotStarTaq. A standard PCR program was used for all amplifications, which consisted of an initial 15 min at 95°C, 14 touchdown cycles of 95°C for 30 s, followed by 1 min annealing, starting 7°C above the TA and reducing by 0.5°C each cycle and 72°C for 1 min, 20 cycles of 95°C for 30 s, TA for 1 min, 72°C for 1 min, and a final extension at 72°C for 10 min. The TAs were as follows: DRB1, 6255°C; DQA1, 5447°C; and DQB1, 7366°C. A negative control containing no DNA template was included.
For each locus, four fluorescence reference standards (FLRs) were generated using a range of alleles from domestic dog and grey wolf. The FLRs were produced by PCR using cloned alleles as templates and a 5'-FAM22-labeled forward primer for each locus. All the resulting FLRs were diluted 1:30 in water before use in the hybridization reactions. In order to form the duplexes between test samples and FLRs, 2 µl of diluted FLR and 2 µl of test sample PCR product were mixed in a 96-well plate and incubated in a thermal cycler at 95°C for 10 min, ramped down to 55°C at 1°C/s, 55°C for 15 min, and 4°C for 15 min. Eight microliters of distilled water were added to each hybridization reaction, and 2 µl was mixed with 4.8 µl of water and 0.2 µl Genescan Rox-500 standard (Applied Biosystems) in a 384-well plate. These samples were run on an ABI 3100 DNA analyzer, using 50 cm capillaries, 4% Genescan nondenaturing polymer (Applied Biosystems), and data were collected using matrix dye set D. The conditions were injection voltage 15 kV, injection time 15 s, run voltage 15 kV, and run temperature 30°C. Data were analyzed using GeneScan and Genotyper software (Applied Biosystems). Using Genotyper, allele peaks formed by control plasmid samples were assigned to "bins" for each FLR used, which were subsequently used to assign alleles in test samples.
Analysis of 21 canine microsatellites within the canine major histocompatibility (MHC) region was also carried out using 46 blood extracted and 18 duplicate buccal swab samples and the WGA-positive and negative controls (AHT121, AHTh171, AHTk253, C22.279, FH2001, FH2054, FH2164, FH2611, FH2247, FH2289, INRA, PEZ08, AHTk211, LEI2D2, FH2326, FH2328, FH2361. PEZ12, PEZ22, FH2305, and PEZ03). DNA (10 ng) was denatured at 95°C for 10 min. A further incubation of 10 min at 85°C followed, during which 10 µl of master mix were added to each sample. Master mix contained 200 µm of each dNTP, 1x buffer without MgCl2, 4.17 mM MgCl2, 2% dimethyl sulfoxide (DMSO), and 0.53 U Taq per sample. The reagents were mixed in a PCR plate and 15 µl of liquid wax were added to the top of each reaction. The plate was covered in plastic wrap and placed in a thermal cycler without the use of a heated lid. Microsatellites were amplified at two temperatures, according to the following protocol: 10 min at 95°C, 10 min at 85°C, 33 cycles of 1 min at 95°C, 30 s at 56°C or 60°C, and 45 s at 72°C, and a final extension of 10 min at 72°C. The full protocol can be found at http://www.vgl.ucdavis.edu/research/canine/ISAG/PCRProtocol.html. The amplified markers were run on an ABI Prism 3100 Genetic Analyzer and the peaks were automatically analyzed and scored using GeneMapper software (version 3) (Applied Biosystems).
| Results |
|---|
|
|
|---|
The 36 buccal swab DNAs, 93 blood extracted DNAs, and three controls (canine DNA, WGA-positive control
-DNA, and WGA-negative controlMilli-Q water) gave clear bands of high molecular weight (>12 kb) and similar intensity (Figure 1A). The WGA of the DNA samples produced a yield of approximately 3 µg of DNA from 2.5 ng of starting material, less than the 4 µg stated in the kit guidelines. The inclusion of the negative control product in all downstream analyses verified that this product was not due to contamination, but was a by-product generated by the random hexamers and
29 DNA polymerase. This by-product is not produced in the sample reactions, as the hexamers bind preferentially to any DNA present in the reaction.
|
The quality of the WGA DNA was assessed using PCR. All PCR experiments included WGA-negative and positive controls and a PCR-negative and positive control. Product was produced only in the WGA PCR-positive control. Ninety-three source DNA and paired WGA DNA samples were amplified in eight separate PCRs and compared. A high level of comparable amplification was seen between source and WGA DNA (Figure 1B), with low failure rates (Table 2). The overall PCR failure rate was marginally poorer for WGA DNA compared with source DNA (4.4% versus 1.6%). Four reactions showed 100% amplification for both source and WGA DNA. Two reactions had a failure rate two times higher in the WGA than the source (7.2% versus 4.2% and 14.6% versus 6.3%, respectively) and two reactions had a six times greater failure rate in WGA compared to source DNA (7.3% versus 0% and 6.3% versus 1%). WGA buccal swab duplicates were amplified using three sets of primers (sets 1, 6, and 8) (Table 1). All duplicates amplified with the exception of two pairs that contained product in one of the duplicates only.
|
Products from eight PCRs were analyzed by DHPLC (WAVE). The pattern distribution for the WGA samples was compared to that obtained from the source DNA. In all cases, patterns were similar in shape and peak height, although the WGA DNA tended to show a slight loss of resolution of peak pattern (Figure 2A). This did not affect pattern assignment, but introduced an occasional additional pattern. Peak height for the source and WGA fragments were comparable for all fragments analyzed Analysis of controls gave no patterns, verifying that nonspecific product had not been formed.
|
Forty-four samples were sequenced for both the source and paired WGA DNA. Sequencing quality of the WGA DNA was comparable to that of the source DNA and showed clear identification of SNPs (Figure 2B). For all but two samples, the sequencing data gave identical trace readings from both source and WGA DNA. The first error occurred where a single base variation changed a T in the source DNA to a Y in the WGA DNA. This replacement occurred in one sample, in the forward orientation. Seven other sequences were obtained for this primer set and these gave the correct sequence traces in the forward orientation. Reverse sequences were of poor quality for all samples. This error could have been generated during WGA, PCR, or the sequencing itself. The second anomaly was a run of Ts (between 12 and 24 in different samples) followed by two Cs (TTTTCYTTTCCYTTTYYTTTTTTTTTTTT(1220)GTCTTTT). The source DNA had a run of 12 Ts followed by 2 Cs, and the WGA sample had a continuous run of 22 Ts and no Cs. This set of samples was sequenced in both forward and reverse orientation in order to minimize error. Close comparison of the forward and reverse sequences revealed that the source DNA contained 12 Ts, while the WGA DNA contained 20 Ts. Sequence alignment showed that the WGA DNA did not contain the 2 Cs prior to the 12 Ts. This misamplification was attributed to "slippage" during the WGA process. WGA buccal swab DNA was not used for sequence analysis.
Three canine MHC loci (DLA-DRB1, DQA1, and DQB1) were assayed using reference strand conformational analysis (RSCA). All results were highly concordant between the source and WGA DNA and had a low failure rate (Table 2). For DLA-DRB1, 49 samples were tested, giving concordant genotypes for 48 samples, with 1 failed sample. DLA-DQA1 gave 90 identical genotypes for 90 paired samples, while 3 failed to amplify. DLA-DQB1 gave 91 identical genotypes with 2 failed samples. For all of these assays, the WGA-negative and positive controls were also analyzed and gave traces comparable to that of the RSCA-negative control. RSCA of buccal swab DNA showed that 13 duplicates were in agreement, 1 duplicate had one failed sample, and 4 duplicates were nonconcordant.
Allelic discrimination using 17 Taqman assays was carried out on both source and WGA DNA. Sixteen assays were carried out on full sample sets of 96, and one on a subset of 48 samples. These assays showed no difference in allele calling between the source and WGA DNA, and gave comparable clustering of alleles (Figure 3). The overall failure rate for both source and WGA DNA was 1.3% (Table 2). The WGA buccal swab duplicates were genotyped using eight Taqman assays. They showed 94.2% concordance (362 calls out of 384), 2.6% undetermined or failed calls (10 calls out of 384), and 3.1% nonconcordance (12 calls out of 384).
|
Source and WGA DNA samples were also analyzed using 21 canine MHC microsatellites. Initial allele calling highlighted 22 samples with discordant genotypes. Further examination revealed the samples showing differences were largely due to poor amplification of either the source or WGA DNA and should have been called as failures. Taking this into account, two clear differences were apparent. The first revealed an allele in the WGA sample to be shifted by 3 bp, the second exhibited allele gain, as the source DNA had two alleles, but the WGA DNA clearly had four. All controls were as expected. The same microsatellite panel was used to evaluate the WGA buccal swab duplicates. From 378 genotypes, 308 were concordant, 37 were nonconcordant, 37 samples failed in one of the duplicates, and 14 failed in both duplicates.
To summarize, 93 blood extracted DNA samples were whole genome amplified and compared to the source DNA in a number of genotypic analyses. Blood extracted DNA sequencing comparisons were good between the two sets of samples and showed zero failure rate but 4.5% nonconcordance for the WGA DNA. Analysis of three MHC loci by RSCA gave a 2.5% failure rate in the WGA DNA, the source DNA had no failures, and comparison of these samples showed 100% concordance. Genotyping by Taqman exhibited the same 1.3% failure rate between source and WGA DNA, and again showed 100% concordance between samples. The microsatellite markers showed the highest failure rate of all the analysis methods, at 5.4% and 4.9% for the source and WGA DNA, respectively. There was 0.21% nonconcordance for these markers.
Buccal swab extracted DNA had higher failure and nonconcordance rates, but the analysis was carried out on fewer samples and used two different rounds of WGA DNA, as source DNA was limited. This has the possibility of introducing errors in one or both of the samples. For the 18 comparable samples, failure and nonconcordance rates were RSCA 3.7% and 0%, respectively; Taqman genotyping 2.6% and 3.1%, respectively; and microsatellites 5.1% and 3.6%, respectively.
| Discussion |
|---|
|
|
|---|
Whole genome amplification of canine DNA using a commercially available MDA-based method was highly effective and produced an average yield of approximately 3 µg of DNA from a starting amount of 2.5 ng. This yield was consistent for all samples, although slightly lower than that specified by the protocol. The DNA produced was of good quality and high molecular weight. The presence of a product within the WGA-negative control was expected from the manufacturers protocol, and inclusion of the negative control in all downstream analyses verified that this product was a by-product generated by the random hexamers in the reaction mix. This by-product is not produced when DNA is present in the reaction.
The samples from freshly extracted DNA were of good quality and gave an extremely high success rate of WGA. In contrast, we have performed WGA on DNA that is old or of poor quality (e.g., buccal swab DNA) and had lower success rates. This would suggest that WGA of DNA should be used primarily as a strategy for expanding small stocks of good quality DNA rather than implementing it as a means of rescuing poor or depleted DNA samples.
The quality of WGA versus source DNA samples as measured by PCR was high. The success of the eight different PCRs performed was very high for both WGA and source DNA, while subsequent work using poorer quality DNA produced similar failure rates between the source and WGA DNA. This again suggests that DNA produced by WGA is representative of genomic DNA and behaves similarly in PCRs.
Whole genome amplification and paired source DNA samples were further tested in a range of molecular tests. The WGA DNA PCR product was of a suitable quality for DHPLC analysis and gave patterns similar to those of the source DNA. In most cases, the WGA amplicons gave patterns that showed slight loss of resolution or peak definition. This loss was consistent throughout the plate of samples, and resulted in the same pattern assignment for most patterns. In a small number of cases (less than three), the loss of resolution gave rise to the assignment of an additional pattern group, however, the sequencing of these "rogue" patterns revealed that they had the same sequence as their source DNA counterparts. Comparison of the peak heights confirmed that a similar yield was obtained from both the source and the WGA DNA.
DNA sequencing proved that the WGA DNA was as good as the source DNA. The sequencing data highlighted two variations between the source and WGA DNA. As an overall percentage of the sequencing total, this is a minimal error rate, and is comparable to that of PCR. Without extensive studies, it is not possible to verify whether the single base variation occurred during the WGA of the DNA or during the PCR. The missing Cs in the run of Ts could be attributed to slippage of the GenomiPhi enzyme.
Reference strand conformational analysis of samples showed high resolution for all three DLA loci tested. Five failures were observed (three in DQA1 and two in DQB1). A single difference was observed for a DRB1 allele, however, this was confirmed to be due to poor amplification of the sample rather than a true variation. The final failure rate of RSCA was 6 out of 235 samples, and no allele differences were assigned. Buccal swab DNA showed nonconcordant alleles, probably due to the poor quality of the DNA prior to WGA.
Single nucleotide polymorphism allelic discrimination was carried out using 17 Taqman assays on source and WGA DNA. All samples in all assays showed complete concordance. While some samples exhibited failures, these were largely consistent with samples that had failed in other methods, and were attributed to poor or failed WGA reactions. This high level of accuracy exhibited throughout these assays indicates the high quality of the WGA DNA. Again, the buccal swab duplicates exhibited a higher failure and nonconcordance rate. This was expected, as the DNA obtained via this method is of a lesser quality than phenol:chloroform extracted blood DNA.
Microsatellite genotyping obtained from these samples showed good reproducibility between source and WGA DNA. Analysis showed 22 samples expressing different allele calls, however, examination of the traces revealed only two real differences. These were found in AHTH171, which showed a 3 bp shift in the WGA sample, and FH2001, which showed four alleles in the WGA sample and only two in the source DNA. Visual examination of the remaining 20 calls classified as different verified that 3 were in agreement but had been put into different "bins" by the software. Of the final 17 traces, 8 samples had poor amplification from the source DNA, and 9 had poor amplification from the WGA DNA. These 17 samples were concluded to be failures. This microsatellite panel worked well on the buccal swab DNA, but gave a higher failure and nonconcordance rate in these samples compared to the blood extracted WGA samples (Table 2).
The overall assessment of the different molecular analyses used demonstrated an extremely high level of concordance and agreement between WGA and source DNA. This was even seen for analysis of microsatellites, where some concern regarding allele slippage has been previously suggested (Debrauwere et al. 1997). We have not specifically addressed the issue of WGA DNA storage and how long it can be used without degradation. This has been a particular issue relating to previous PCR-based methods for WGA. Our experience using this particular MDA-based method has been that amplified DNA stored at 20°C for more than 6 months and thawed up to five times has had no observable loss of function or increase in error rate. Samples are stored in reaction buffer and no attempt has been made to determine whether TE buffer or water is preferable for long-term storage.
In conclusion, the use of this MDA-based method for WGA of canine DNA works well and has major potential for making samples more accessible for study and easier to collect. This technique will enhance and improve the number and type of analyses carried out in canine genetic studies.
| Acknowledgments |
|---|
This article was presented at the 2nd International Conference on the "Advances in Canine and Feline Genomics: Comparative Genome Anatomy and Genetic Disease," Universiteit Utrecht, Utrecht, The Netherlands, October 1416, 2004.
| Footnotes |
|---|
Corresponding Editor: Kerstin Lindblad-Toh
| References |
|---|
|
|
|---|
-
Barker DL, Hansen MST, Faruqi AF, Giannola D, Irsula OR, Lasken RS, Latterich M, Makarov V, Oliphant A, Pinter JH, Shen R, Sleptsova I, Ziehler W, and Lai E, 2004. Two methods of whole-genome amplification enable accurate genotyping across a 2320-SNP linkage panel. Genome Res 14:901907.
Blanco L, Bernad A, Lazaro JM, Martin G, Garmendia C, and Salas M, 1989. Highly efficient DNA synthesis by the phage phi 29 DNA polymerase. Symmetrical mode of DNA replication. J Biol Chem 264:89358940.
Cargill EJ, Famula TR, Strain GM, and Murphy KE, 2002. Multiplexing of canine microsatellite markers for whole-genome screens. Genomics 80:250253.[CrossRef][ISI][Medline]
Debrauwere H, Gendrel CG, Lechat S, and Dutreix M, 1997. Differences and similarities between various tandem repeat sequences: minisatellites and microsatellites. Biochimie 79:577586.[Medline]
Dean FB, Hosono S, Fang L, Wu X, Faruqi AF, Bray-Ward P, Sun Z, Zong Q, Du Y, Du J, Driscoll M, Song W, Kingsmore SF, Egholm M, and Lasken RS, 2002. Comprehensive human genome amplification using multiple displacement amplification. Proc Natl Acad Sci USA 99:52615266.
Gorrochotegui-Escalante N and Black WC, 2003. Amplifying whole insect genomes with multiple displacement amplification. Insect Mol Biol 12:195200.[CrossRef][Medline]
Hosono S, Faruqi AF, Dean FB, Du Y, Sun Z, Wu X, Du J, Kingsmore SF, Egholm M, and Lasken RS, 2003. Unbiased whole-genome amplification directly from clinical samples. Genome Res 13:954964.
Kittler R, Stoneking M, and Kayser, M, 2002. A whole genome amplification method to generate long fragments from low quantities of genomic DNA. Anal Biochem 300:237244.[Medline]
Lasken RS and Egholm M, 2003. Whole genome amplification: abundant supplies of DNA from precious samples or clinical specimens. Trends Biotechnol 21:531535.[CrossRef][ISI][Medline]
Mai M, Hoyer JD, and McClure RF, 2004. Use of multiple displacement amplification to amplify genomic DNA before sequencing of the alpha and beta haemoglobin genes. J Clin Pathol 57:637640.
Sorensen KJ, Turteltaub K, Vrankovich G, Williams J, and Christian AT, 2004. Whole-genome amplification of DNA from residual cells left by incidental contact. Anal Biochem 324:312314.[Medline]
Wagner LJ, Burnett RC, DeRosa SA, and Storb R, 1996. Molecular analysis and polymorphism of the DLA-DQA gene. Tissue Antigens 48:199204.[ISI][Medline]
Wells D, Sherlock JK, Handyside AH, and Delhanty JD, 1999. Detailed chromosomal and molecular genetic analysis of single cells by whole genome amplification and comparative genomic hybridisation. Nucleic Acids Res 27:12141218.
This article has been cited by other articles:
![]() |
M. Amoli, D Carthy, H Platt, and W. Ollier EBV Immortalization of human B lymphocytes separated from small volumes of cryo-preserved whole blood Int. J. Epidemiol., April 1, 2008; 37(suppl_1): i41 - i45. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Chang, R. L. Terrill, M. M. Bautista, E. J. Carlson, D. J. Dyer, K. L. Overall, and S. P. Hamilton Large-Scale SNP Genotyping with Canine Buccal Swab DNA J. Hered., August 9, 2007; (2007) esm044v2. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



blank/negative control; allele 1; 
