Journal of Heredity Advance Access originally published online on October 27, 2006
Journal of Heredity 2006 97(6):595-598; doi:10.1093/jhered/esl034
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Brief Communications |
Wild and Aquaculture Populations of the Eastern Oyster Compared Using Microsatellites
From the School of Marine Science, Virginia Institute of Marine Science, College of William and Mary, PO Box 1346, Gloucester Point, VA 23062-1346 (Carlsson, Morrison, and Reece); and the US Geological Survey-BRD, Aquatic Ecology Barnach, 11649 Leetown Road, Kearneysville, WV 25430 (Morrison)
Address correspondence to J. Carlsson at the address above, or e-mail: jc{at}vims.edu.
Five new microsatellite markers were developed for the eastern oyster (Crassostrea virginica), and allelic variability was compared between a wild Chesapeake Bay population (James River) and a hatchery strain (DEBYTM). All loci amplified readily and demonstrated allelic variability with the number of alleles ranging from 16 to 36 in the wild population and from 11 to 19 in the DEBYTM strain. Average observed and expected heterozygosities were estimated at 0.66 and 0.80 in the hatchery sample. The corresponding estimates were 0.91 and 0.75 in the wild sample. Results indicated lower genetic variability in the DEBYTM strain and significant genetic differentiation between the wild population and hatchery strain. These microsatellite loci will prove valuable for future population genetic studies and in tracking of hatchery strains used in restoration.
Historically, the primary commercial oyster species of the eastern United States, Crassostrea virginica (Gmelin 1791), supported an extensive fishery in Chesapeake Bay. Overfishing, loss of habitat, pollution and diseases, however, have depleted present populations to a fraction of historical sizes (e.g., Burreson and Andrews 1988; Rothschild et al. 1994). The decline has prompted several restoration strategies including construction of artificial reefs followed by stocking with various oyster strains. Due to high pathogen pressure, the disease-tolerant DEBYTM strain (Burreson 1991; Ragone Calvo et al. 2003) has been used for stocking reefs in the Virginia portion of Chesapeake Bay. Recently developed population genetic statistical methods such as assignment tests (reviewed by Hansen et al. 2001) can determine the population of origin for single or groups of individuals and could potentially be used to examine the breeding success of deployed oysters. These tests, however, require genetic differentiation among potential source populations that often only can be discerned by using highly variable molecular markers, such as microsatellites. Many microsatellite markers may need to be developed and screened in order to identify a suit of loci that are most powerful and efficient for population genetic analyses. Toward this effort, we have developed 5 microsatellite loci and tested them on a wild population and a hatchery strain of C. virginica.
 |
Materials and Methods |
|---|
 Top Materials and Methods Results and DiscussionReferences |
|---|
Primer Development
Microsatellite loci Cvi8VIMS and Cvi12VIMS were identified from a C. virginica genomic library as previously described (Reece et al. 2004). Loci Cvi4VIMS, Cvi5VIMS, and Cvi18VIMS were isolated from C. virginica genomic DNA following a modified (McDowell et al. 2002) method of Hamilton et al. (1999). Primers (Table 1) were designed with PRIMER3 (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). A T3 tail (AATTAACCCTCACTAAAGGG) was added to the 5' end of the forward primers. DNA was extracted from 2 collections of C. virginica (Table 2) by using the Dneasy Tissue Kit (Qiagen Inc., Santa Clara, CA). Polymerase chain reaction (PCR) amplifications (5 µl) contained 5–50 ng template DNA and reagents (Invitrogen, Carlsbad, CA) as follows: 0.5 µl 10x buffer, 1.0–2.0 mM MgCl2, 1 µl of 2% bovine serum albumin, 0.2 mM deoxynucleoside triphosphate mix, 0.025 pmol of forward primer, 0.1 pmol of reverse primer, 0.025 units of Taq polymerase, and 0.1 pmol fluorescently labeled T3 primer (source indicated in Table 1). Cycling parameters were 94 °C for 3 min followed by 35 cycles at 94 °C for 1 min, annealing (temperatures indicated in Table 1) for 1 min, 72 °C for 1 min, with a final extension at 72 °C for 7 min. Amplified products where run with a size standard on an ABI 3100 Prism Genetic Analyzer (Applied Biosystems, Forest City, CA) according to the manufacturer's recommendations. Allele scoring was performed with GENEMARKER (SoftGenetics, State College, PA). Optimization of annealing temperatures and MgCl2 concentrations was done by performing gradient PCRs on a set of 8 individuals (24 different temperatures ranging from 45.0 to 65.0 °C) with 1.0, 1.5, and 2.0 mM MgCl2. The annealing temperature and MgCl2 concentration that yielded the clearest amplification and that allowed for unambiguous allele scoring was selected and used for amplifying the remaining individuals.
|
|
= 0.05/5 = 0.01)Sample Comparisons
Oysters were collected from the Horsehead Bar in the lower James River (VA) in 2004, and the sample of hatchery-reared, disease-resistance selected line of DEBYTM oysters were obtained in 2002. The James River has historically produced extensive numbers of seed oysters and is still regarded as one of the most productive oyster habitats in Virginia (cf. MacKenzie 1996). The Horsehead Bar sample should represent a natural condition, uncontaminated by transplantation or stocking. Although numerous oysters have been transplanted from the James River, there are no records of oysters being transplanted to the James River (cf. MacKenzie 1996). The DEBYTM oysters originate from Delaware Bay wild oysters and were brought to the hatchery at Virginia Institute of Marine Science in 1987, where a selective breeding program was initiated that continues to this date (Burreson 1991). The main objective was to create disease-resistant (particularly against Dermo and MSX) brood stock for aquaculture (Burreson 1991; Ragone Calvo et al. 2003).
Samples of 96 wild C. virginica from the James River and 96 hatchery-bred DEBYTM strain oysters (F5 generation) were screened for variation at these 5 microsatellite loci. Approximately 20% of all individuals were rerun to ensure repeatability of allele scoring. Samples failing to amplify the first time were reamplified once. The MICRO-CHECKER 2.2.1 software (van Oosterhout et al. 2004) was used for identifying possible genotyping errors (i.e., stuttering, large allele dropout, and null alleles, 1000 randomizations). GENEPOP 3.1b (Raymond and Rousset 1995) was used to identify deviations from Hardy–Weinberg equilibrium, HWE (exact tests, 1000 iterations), observed and expected heterozygosities (indicating an excess or deficiency of heterozygotes), and genotypic disequilibrium (1000 iterations). FSTAT 2.9.3.2 [EC] (Goudet 1995) was used to calculate allelic richness and FIS (Weir and Cockerham 1984) per locus and sample. The ARLEQUIN 3.0 software (Excoffier et al. 2005) was used to calculate single-locus FST and global multilocus FST values (10 100 permutations) (Weir and Cockerham 1984). Significance levels were adjusted for multiple tests using the sequential Bonferroni correction technique (Rice 1989).
|
Results and Discussion |
|---|
|
TopMaterials and MethodsResults and DiscussionReferences |
|---|
Number of alleles varied from 11 at locus Cvi5VIMS to 36 at locus Cvi4VIMS (Table 2). Significantly fewer alleles were found in the DEBYTM strain compared with the wild sample (Kruskal–Wallis test, P = 0.027). Overall allelic richness varied from 10.8 to 36.3 (Table 2), with the wild population showing significantly higher allelic richness than the DEBYTM strain (Kruskal–Wallis test, P = 0.047).
The MICRO-CHECKER analysis indicated that the loci Cvi4VIMS and Cvi8VIMS might be influenced by one or more null alleles in both the wild and hatchery samples and that locus Cvi18VIMS in the hatchery sample could be affected by null alleles. This observation indicates that using Cvi4VIMS and Cvi8VIMS for population genetic analyses that assume HWE may prove to be problematic. Hence, we estimated global multilocus FST both with and without these 2 loci. With Cvi18VIMS, on the other hand, there were indications of null alleles only in the hatchery sample and, therefore, this locus was included in all further analyses.
There were no indications that genotyping errors affected allele scoring (e.g., allele dropouts or stuttering) at any of the markers in any of the samples. Samples that failed to amplify were rare (cf. Table 2) and indicate that null homozygotes were not common. In addition, no sample failed to amplify at more than one locus (data not shown), and this makes it unlikely that poor DNA quality affected our results. Observed heterozygosity ranged from 0.39 at locus Cvi18VIMS to 0.98 at locus Cvi12VIMS, whereas expected heterozygosity varied from 0.67 at Cvi18VIMS to 0.96 at locus Cvi4VIMS (Table 2). Inbreeding coefficients (FIS) varied among markers from –0.06 (Cvi12VIMS) to 0.49 (Cvi4VIMS) in the hatchery strain and from –0.01 (Cvi5VIMS) to 0.529 (Cvi4VIMS) in the wild sample (cf. Table 2). Average FIS including all markers was 0.21 in the hatchery line and 0.19 in the wild sample. The average FIS when excluding the Cvi4VIMS and Cvi8VIMS markers was considerably lower and estimated to be 0.10 in the hatchery strain and 0.06 in the wild sample.
Cvi5VIMS and Cvi4VIMS showed significant genotypic disequilibrium in the hatchery strain, even after sequential Bonferroni correction for multiple tests (data not shown). Significant departures from HWE were found at Cvi18VIMS in the DEBYTM strain and at Cvi4VIMS and Cvi8VIMS in both samples (Table 2). Corresponding heterozygote deficiency was significant in both the wild and hatchery collection for markers Cvi4VIMS (P < 0.001) and Cvi8VIMS (P < 0.001). Cvi18VIMS (P = 0.003) showed heterozygote deficiency only in the hatchery collection.
Previously, many microsatellites markers developed for C. virginica have deviated from HWE usually in the direction of deficiencies of heterozygotes (Reece et al. 2004). General causes for such deviations include substructuring of the population sample, inbreeding, or the presence of null alleles (Zouros and Foltz 1984); however, from results of previous studies on Crassostrea spp., null alleles seem to be a likely explanation (McGoldrick et al. 2000; Reece et al. 2004). Of note, such deviations appear to be quite common in microsatellite markers for bivalves (e.g., Eackles and King 2002). High frequency of null alleles may complicate many types of population genetic analyses that rely on HWE, as false homozygotes would be common (e.g., Pemberton et al. 1995; de Sousa et al. 2005). There are available methods to correct allele frequencies for null alleles (cf. Brookfield 1996; Summers and Amos 1997), although using loci with low frequency or absence of null alleles is less complex and preferred.
Significant single-locus FST estimates between samples were detected at all markers (P < 0.001, Table 2), and the global multilocus FST including all loci was estimated to be 0.076 (P < 0.001), and when excluding Cvi4VIMS and Cvi8VIMS (due to the high likelihood of null alleles), it was estimated at 0.095 (P < 0.001). The significant FST estimates indicate genetic differentiation between the DEBYTM strain and wild sample. Lower allele richness observed in the DEBYTM strain, as compared with the wild sample, may be caused by hatchery selection and inbreeding (cf. Table 2). Continued hatchery amplification of the DEBYTM strain might lead to decreased genetic variability if the number of effective breeders is not maintained. Hence, continued genetic monitoring of the strain is warranted.
There are several studies on aquatic organisms, especially salmonids, which argue that hatchery-bred strains have reduced fitness when exposed to natural environments, as compared with their wild counterparts (see Hansen 2002 and references therein). If reduced microsatellite variability also correlates to reduced variability at genes under selection, the use of genetically depauperate hatchery strains for restoration efforts may be unwise as this reduction in genetic variation can diminish the ability of a population to respond to other stressors. In addition, hatchery strains may be subjected to specific and unique selective forces in the hatchery, which might be very different from those encountered on natural restoration sites. The strong genetic differentiation observed here demonstrates that microsatellite markers can detect population structure in C. virginica and will be useful for population genetic studies including assignment tests, pedigree analysis and mapping studies.
|
Acknowledgments |
|---|
We thank Georgeta Constantin and Elizabeth Francis for laboratory assistance. This study was supported by NOAA Chesapeake Bay office, Cooperative Agreement (contract no. NA04NMF4570386), and is VIMS contribution no. 2746.
|
Footnotes |
|---|
Corresponding Editor: Brian Bowen
Received December 2, 2005
Accepted July 17, 2006
|
References |
|---|
|
TopMaterials and MethodsResults and DiscussionReferences |
|---|
-
Brookfield JFY. (1996) A simple new method for estimating null allele frequency from heterozygote deficiency. Mol Ecol 5:453–455.[CrossRef][Medline]
Burreson EM and Andrews JD. (1988) Unusual intensification of Chesapeake Bay oysters diseases during recent drought conditions. Proc Ocean's '88 Conference(Institute of Electrical and Electronic Engineers (IEEE), Piscataway (NJ)) pp. 799–802.
Burreson EM. (1991) Effects of Perkinsus marinus infection in the eastern oyster, Crassostrea virginica: I. Susceptibility of native and MSX-resistant stocks. J Shellfish Res 10:417–423.
de Sousa SN, Finkeldey R, Gailing O. (2005) Experimental verification of microsatellite null alleles in Norway spruce (Picea abies [L.] Karst.): implications for population genetic studies. Plant Mol Biol Rep 23:113–119.
Eackles MS and King TL. (2002) Isolation and characterization of microsatellite loci in Lampsilis abrupta. Mol Ecol Notes 2:559–562.[CrossRef]
Excoffier L, Laval G, Schneider S. (2005) Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evol Bioinform Online 1:47–50.
Goudet J. (1995) FSTAT (vers. 1.2): a computer program to calculate F-statistics. J Hered 86:485–486.
Hamilton MB, Pincus EL, Di Fiore A, Fleischer RC. (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 27:500–507.[Web of Science][Medline]
Hansen MM. (2002) Estimating the long-term effects of stocking domesticated trout into wild brown trout (Salmo trutta) populations: an approach using microsatellite DNA analysis of historical and contemporary samples. Mol Ecol 11:1003–1015.[CrossRef][Medline]
Hansen MM, Kenchington E, Nielsen EE. (2001) Assigning individual fish to populations using microsatellite DNA markers: methods and applications. Fish Fish 2:93–112.
MacKenzie CL Jr. (1996) The history of oyster fishery in U.S. and Canadian waters. Mar Fish Rev 58:1–87.
McDowell JR, Diaz-Jaimes P, Graves JE. (2002) Isolation and characterization of seven tetranucleotide microsatellite loci from Atlantic northern bluefin tuna Thunnus thynnus thynnus. Mol Ecol Notes 2:214.[CrossRef]
McGoldrick DJ, Hedgecock D, English L, Baoprasertkul P, Ward RD. (2000) The transmission of microsatellite alleles in Australian and North American stocks of the Pacific oyster (Crassostrea gigas): selection and null alleles. J Shellfish Res 19:779–788.
Pemberton JM, Slate J, Bancroft DR, Barrett JA. (1995) Nonamplifying alleles at microsatellite loci: a caution for parentage and population studies. Mol Ecol 4:249–252.[Medline]
Ragone Calvo LM, Calvo GW, Burreson EM. (2003) Dual disease resistance in a selectively bred eastern oyster, Crassostrea virginica, strain tested in Chesapeake Bay. Aquaculture 220:69–87.[CrossRef]
Raymond M and Rousset F. (1995) GENEPOP (version 1.2) population genetics software for exact test and ecumenicism. J Hered 86:248–249.
Reece KS, Ribeiro WL, Gaffney PM, Carnegie RB, Allen SK Jr. (2004) Microsatellite marker development and analysis in the eastern oyster, Crassostrea virginica: confirmation of null alleles and non-Mendelian segregation ratios. J Hered 95:355–361.
Rice WR. (1989) Analyzing tables of statistical tests. Evolution 43:223–225.[CrossRef][Web of Science]
Rothschild BJ, Ault JS, Goulletquer P, Héral M. (1994) Decline of the Chesapeake Bay oyster population: a century of habitat destruction and overfishing. Mar Ecol Prog Ser 111:29–39.
Summers K and Amos W. (1997) Behavioral, ecological, and molecular genetic analyses of reproductive strategies in the Amazonian dart-poison frog, Dendrobates ventrimaculatus. Behav Ecol 8:260–267.
van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. (2004) Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 4:135.
Weir BS and Cockerham CC. (1984) Estimating F-statistics for the analysis of population structure. Evolution 38:1358–1370.[CrossRef][Web of Science]
Zouros E and Foltz DW. (1984) Possible explanations of heterozygote deficiency in bivalve molluscs. Malacologia 25:583–591.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Carlsson Effects of Microsatellite Null Alleles on Assignment Testing J. Hered., November 1, 2008; 99(6): 616 - 623. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||