Journal of Heredity Advance Access originally published online on December 22, 2006
Journal of Heredity 2007 98(2):165-168; doi:10.1093/jhered/esl059
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Brief Communications |
Evolution and Differentiation of MSHR Gene in Different Species
From the Department of Animal Science, College of Animal Science and Technology, Agricultural University of Hebei, Baoding 071001, China
Address correspondence to X.-L. Li at the address above, or e-mail: lixianglongcn{at}yahoo.com.
Coat color offers some prospects for evolutionary studies due to its large amount of presumably adaptive coat color variation and conserved genetic mechanisms of generating different coat colors in different species. Melanocyte-stimulating hormone receptor (MSHR) gene is responsible for intraspecific and interspecific color variation in mammals and birds. A total number of 206 MSHR gene sequences belonging to 84 species, 58 genera, and 20 families were analyzed to investigate its evolution and differentiation in different species. Most of the species have 954 bp and stop codon TGA. Species in Callithrix and Callimico have a stop codon mutation from TGA to TGG and elongate 81 bp with TAG as stop codon. Species in Phasianidae, Fringillidae, and Lemuridae also use TAG as stop codon. The Sus scrofa had an insertion of AACCAGACC encoding Asn-Gln-Thr from 85 to 93 bp. In Bovidae, a brown strain of cow with 966 bp due to the 12-bp duplication of GGCATTGCCCGG from 670 to 681 bp encoding for Gly-Ile-Ala-Arg was found. Teiidae has the smallest number of total mutations (6), silent mutations (3), nonsynonymous mutations (3), average number of nucleotide differences (1.519), synonymous nucleotide diversity (
(s) = 0.0030), and nonsynonymous nucleotide diversity ((a) = 0.0029), and Hominidae, Lemuridae, Canidae, and Teiidae have higher ratio of (a)/(s) (0.537–0.973). The reconstructed phylogenetic tree of MSHR gene of families is basically consistent with the taxonomy of National Center for Biotechnology Information.
Evolution depends on natural selection acting on phenotypic variation, but the molecular genetic basis of phenotypic change during evolution is difficult to study, and the genes responsible for phenotypic variation in natural populations are rarely known because the genes involved are usually unknown and may only have small effects. However, evolutionary studies of coat color offer some prospects for success due to the large amount of presumably adaptive coat color variation and conserved genetic mechanisms of generating different coat colors in different species. The wealth of information on the genetics of pigmentation and the clear fitness consequences of many pigmentation phenotypes provide an opportunity to study the molecular basis of an ecologically important trait. Melanocyte-stimulating hormone receptor (MSHR), the coat color extension locus of animals, was also known as alpha-MSHR, the melanocortin-1 receptor. The relative proportions of pheomelanin and eumelanin are regulated by melanocyte-stimulating hormone, which acts via MSHR on melanocytes, to increase the synthesis of eumelanin. So the MSHR gene is responsible for intraspecific and interspecific color variation in mammals and birds and is considered as one of the animals' candidate gene for research on coat, hair, or skin color variation. Studies on MSHR in domestic and laboratory mammals showed that gain-of-function mutations in MSHR led to increased production of eumelanin in coats, whereas loss-of-function mutations led to increased pheomelanin production (mice: Robbins et al. 1993; cattle: Klungland et al. 1995; horses: Marklund et al. 1996; pigs: Kijas et al. 1998; sheep: Vage et al. 1999; dogs: Newton et al. 2000; bananaquit: Emmalize et al. 2001; pocket mice: Nachman et al. 2003; Aspidoscelis inornata: Rosenblum et al. 2004). Our study also suggested that the red head and neck of Boer goats might be controlled by the recessive allele of the MSHR gene (Wu et al. 2006). Most of the reports on MSHR gene are focused on the variation of this gene and its relationship with coat, hair, or skin color or intraspecific comparisons, and few studies are focused on interspecific evolution of MSHR gene except for its evolution in Primates (Mundy and Kelly 2003) and vertebrates (Mundy et al. 2003). In this paper, a total number of 206 MSHR gene sequences from different species were obtained from GenBank and were analyzed in order to provide useful data for its study in evolution and differentiation within and among different species.
 |
Materials and Methods |
|---|
 Top Materials and Methods Results and DiscussionSupplementary MaterialReferences |
|---|
A total of 206 sequences belonging to 84 species in 58 genera of 20 families with complete coding sequence were obtained, in which 204 sequences were from GenBank and 2 were from Boer goat and Saanen dairy goat sequenced by Bioasia Biological and Technology Co. Ltd (Beijing, China) (see supplementary material on file). The taxon of each sequence was according to the taxonomy of National Center for Biotechnology Information (NCBI).
Thirty-three sequences were analyzed for A. inornata; 20 for Homo sapiens and Sus scrofa; 18 for Chaetodipus intermedius; 9 for Bos taurus; 7 for Coereba flaveola; 5 for Gallus gallus; 4 for Holbrookia maculata and Mus musculus; 3 for Capra hircus and Felis catus; 2 for Alouatta seniculus, Alopex lagopus, Canis familiaris, Coturnix japonica, and Phrynosoma platyrhinos; and a single sequence for all remaining species (supplementary material: Sequences of different animals from GenBank).
All the sequences were aligned using BIOEDIT (Version 7.0.5.2
[EC]
). The DNASP (Version 4.0) software was used to analyze the polymorphic sites, the average number of nucleotide differences (K, Tajima 1983), synonymous nucleotide diversity ((s)), nonsynonymous nucleotide diversity ((a)), the number of total mutations (M), the total number of silent mutations (SIM), the total number of nonsynonymous mutations (NSM) for each family, and the average number of nucleotide substitution per site (Dxy) between families. The phylogenetic tree was reconstructed for all families by MEGA 3.1 software using neighbor joining (NJ) method, unweighted pair group method with arithmetic mean (UPGMA) method, and minimum evolution (ME) method based on the average number of nucleotide substitution per site (Dxy) between families.
|
Results and Discussion |
|---|
|
TopMaterials and MethodsResults and DiscussionSupplementary MaterialReferences |
|---|
Sequence Length Variation within and among Different Species
Most of the analyzed species have a coding region of 954 bp for the MSHR gene, but there is also length variation within and among species (see supplementary material). Four species, Callithrix jacchus, Callithrix geoffroyi, Callithrix argentata, and Callithrix pygmaea have the longest length of 1035 bp, as well as Callimico goeldii. Meanwhile, the stop codon of these species had mutated from TGA to TGG encoding tryptophan and had an 81-bp elongation of CCGGGGTGCTGGGCAGAGGGAGGTGGTGATAGTGTGTGGCCTGGCTCCTGTGTGACCCTGCGTGGTCCCTTACCTCCCTAG encoding PGCWAEGGGDSVWPGSCVTLRGPLPP after the stop codon mutation. The 81-bp elongation was also conserved during the long period of evolution and differentiation, except the 964T>G transversion. Meanwhile, the stop codon had become TAG, which was also conserved in Phasianidae, Fringillidae, and Lemuridae. In contrast, Iguanidae including H. maculata, P. platyrhinos, and Uta stansburiana used TAA as stop codon and conserved. One variation (AY237398 [GenBank] ) in Herpailurus yaguarondi had the shortest length of 930 bp with a 24-bp deletion from 283 to 306 bp. Another variation type (AY237397 [GenBank] ) in Panthera onca had 939 bp with a 15-bp deletion from 304 to 318 bp.
Only S. scrofa was analyzed in Suidae. Sus scrofa had an insertion of AACCAGACC encoding Asn-Gln-Thr from 85 to 93 bp, which is also a duplication of AACCAGAC, and other families do not have this. Few variations were also found in this insertion region except for one transition of 85A>G in Yorkshire (AY365255 [GenBank] ). So it could be inferred that this kind of insertion region was conserved during evolution and differentiation. Whether this specific variation is specific to S. scrofa or not needs to be investigated further in genus Sus. Two pig sequences, Landrace (AY365253 [GenBank] ) and Yorkshire (AY365255 [GenBank] ), have another insertion of CCC at 68, 69, and 70, encoding Pro. Therefore, the length of pig MSHR gene varies from 963 to 966 bp. Berkshire (AY365249 [GenBank] ) has 964 bp due to a C insertion at the corresponding insertion position of CCC in Landrace (AY365253 [GenBank] ) and Yorkshire (AY365255 [GenBank] ).
In Iguanidae, 4 sequences from H. maculata, 2 from P. platyrhinos, and 1 from U. stansburiana were all 948 bp, whereas most of the species in Phasianidae and Fringillidae had 945 bp except for 942 bp of one variation type (AB201632 [GenBank] ) with a deletion of 3 bp. All the species in Heteromyidae and Muridae had 954 bp except for 948 bp of M. musculus due to a 6-bp deletion from 50 to 55 bp. In Bovidae, a brown strain of cow (AJ297819 [GenBank] ) has 966 bp due to the 12-bp duplication of GGCATTGCCCGG from 670 to 681 bp, encoding for Gly-Ile-Ala-Arg.
Stop Codon Variation among Different Families
Most of the families had the stop codon TGA, whereas some families used TAG or TAA as the stop codon. Phasianidae including G. gallus, C. japonica, and Coturnix chinensis and Fringillidae including C. flaveola and Tangara cucullata had the stop codon TAG. Lemuridae including Lemur, Hapalemur, and Eulemur also used TAG as stop codon. Callithrix including C. jacchus, C. geoffroyi, C. argentata, and C. pygmaea and Callimico including C. goeldii not only had an 81-bp elongation after stop codon mutation from TGA to TGG but also had the same stop codon TAG. Iguanidae including H. maculata, P. platyrhinos, and U. stansburiana used TAA as stop codon.
Phylogenetic Tree of Families and Genetic Diversity within and among Families
The phylogenetic tree of all families reconstructed by NJ, UPGMA, and ME methods had the same results and was basically consistent with the taxonomy of NCBI (Figure 1). The divergence time among families was also labeled on the scale bar calculated according to the average nonsynonymous nucleotide rate (0.85 x 10–9 per year, Li and Dan 1991). Using BIOEDIT, we aligned the 1059 bp of 206 sequences, allowing gaps. The results of DNASP analysis indicated that the selected region (1–1059) of 206 sequences from different species has 881 sites, excluding sites with gaps. There are 249 invariable (monomorphic) sites and 632 variable (polymorphic) sites that include 49 singleton variable sites and 583 parsimony-informative sites. Among the 49 singleton variable sites, there are 44 sites with 2 variants and 5 sites with 3 variants. There are 287 sites with 2 variants, 193 sites with 3 variants, and 103 sites with 4 variants in the 583 parsimony-informative sites. The nucleotide diversity and average number of nucleotide differences for all sequences are 0.1807 and 159.16, respectively.
|
The genetic diversity of MSHR gene for each family is listed in Table 1. Different families have different genetic diversity estimates for the MSHR gene. Teiidae has the smallest number of total mutations (6), silent mutations (3), nonsynonymous mutations (3), average number of nucleotide differences (1.519), synonymous nucleotide diversity (0.0030), and nonsynonymous nucleotide diversity (0.0029), and Hominidae, Suidae, Heteromyidae, Canidae, Fringillidae, and Felidae also have smaller average number of nucleotide differences and nucleotide diversity. Cebidae has the largest number of total mutations (114), silent mutations (63), and nonsynonymous mutations (51); and Lemuridae and Muridae have the largest average number of nucleotide differences (46) and synonymous nucleotide diversity (0.1139); and Cercopithecidae, Cebidae, Bovidae, Cervidae, Muridae, and Iguanidae also have larger average number of nucleotide differences and nucleotide diversity. Hominidae, Canidae, and Teiidae have higher ratio of
(a)/(s) (0.537–0.973).
|
In summary, during long period of evolution, the MSHR gene conserved 28.26% (249 of 881 nt) sequence among different families. Most of the species have 954 bp and stop codon of TGA. Species in Callithrix and Callimico have a stop codon mutation from TGA to TGG and elongate 81 bp with TAG as stop codon. Species in Phasianidae, Fringillidae, and Lemuridae also use TAG as stop codon. The S. scrofa had an insertion of AACCAGACC, and a brown strain cow in Bovidae had a 12-bp duplication of GGCATTGCCCGG. Teiidae has the smallest number of mutations and an average number of nucleotide differences, synonymous nucleotide diversity, and nonsynonymous nucleotide diversity. Hominidae, Lemuridae, Canidae, and Teiidae have high ratios of
(a)/(s). |
Supplementary Material |
|---|
|
TopMaterials and MethodsResults and DiscussionSupplementary MaterialReferences |
|---|
Supplementary material can be found at http://www.jhered.oxfordjournals.org/.
|
Acknowledgments |
|---|
This work was supported by National Natural Science Foundation of China (No. 30571326).
|
Footnotes |
|---|
Corresponding Editor: Susan Lamont
Received May 16, 2006
Accepted September 19, 2006
|
References |
|---|
|
TopMaterials and MethodsResults and DiscussionSupplementary MaterialReferences |
|---|
-
Emmalize T, Kim H, Eldredge B, Robert ER, Nicholas IM. (2001) The molecular basis of an avian plumage polymorphism in the wild: a melanocortin-1-receptor point mutation is perfectly associated with the melanic plumage morph of the bananaquit. Curr Biol 11:550–557.[CrossRef][Web of Science][Medline]
Kijas JMH, Wales R, Törnsten A, Chardon P, Moller M, Andersson L. (1998) Melanocortin receptor 1 (MC1R) mutations and coat color in pigs. Genetics 150:11771185.
Klungland H, Vage DI, Gomez-Raya L, Adalsteinsson S, Lien S. (1995) The role of melanocyte-stimulating hormone (MSH) receptor in bovine coat color determination. Mamm Genome 6:9636–639.[CrossRef][Web of Science][Medline]
Li WH and Dan G. (1991) Fundamentals of molecular evolution(Sinauer Associates, Inc, Sunderland (MA)).
Marklund L, Johansson MM, Sandberg K, Andersson L. (1996) A missense mutation in the gene for melanocyte-stimulating hormone receptor (MC1R) is associated with the chestnut coat color in horses. Mamm Genome 7:895–899.[CrossRef][Web of Science][Medline]
Mundy NI and Kelly J. (2003) Evolution of a pigmentation gene, the melanocortin-1 receptor, in Primates. Am J Phys Anthropol 121:67–80.[CrossRef][Web of Science][Medline]
Mundy NI, Kelly J, Theron E, Hawkins K. (2003) Evolutionary genetics of the melanocortin-1 receptor in vertebrates. Ann N Y Acad Sci 994:307–312.[Web of Science][Medline]
Nachman MW, Hoekstra HE, D'Agostino SL. (2003) The genetic basis of adaptive melanism in pocket mice. Proc Natl Acad Sci USA 100:5268–5273.
Newton JM, Wilkie AL, He L, Jordan SA, Metallinos DL, Holmes NG, Jackson IJ, Barsh GS. (2000) Melanocortin 1 receptor variation in the domestic dog. Mamm Genome 11:24–30.[CrossRef][Web of Science][Medline]
Robbins LS, Nadeau JH, Johnson KR, Kelly MA, Roselli-Rehfuss L, Baack E, Mountjoy KG, Cone RD. (1993) Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 72:827–834.[CrossRef][Web of Science][Medline]
Rosenblum EB, Hoekstra HE, Nachman MW. (2004) Adaptive reptile color variation and the evolution of the Mc1r gene. Evolution 58:81794–1808.[CrossRef][Web of Science][Medline]
Tajima F. (1983) Evolutionary relationship of DNA sequences in finite populations. Genetics 105:437–460.
Vage DI, Klungland H, Lu D, Cone RD. (1999) Molecular and pharmacological characterization of dominant black coat color in sheep. Mamm Genome 10:139–43.[CrossRef][Web of Science][Medline]
ZhL Wu, Li XL, Liu YQ, Gong YF, ZhZh Liu, Wang XJ, Xin TR, Ji Q. (2006) The red head and neck of Boer goats may be controlled by the recessive allele of the MC1R gene. Anim Res 55:4313–322.[CrossRef]
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||