Journal of Heredity Advance Access published online on July 9, 2007
Journal of Heredity, doi:10.1093/jhered/esm042
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
QTL Analysis of Low TemperatureInduced Browning in Soybean Seed Coats
From the National Institute of Crop Science, 2-1-18 Kannondai, Tsukuba, Ibaraki 305-8518, Japan (Githiri, Yang, and Takahashi), University of Tsukuba, 2-1-18 Kannondai, Tsukuba, Ibaraki 305-8518, Japan (Khan and Takahashi) JIRCAS, 1-1 Owashi, Tsukuba, Ibaraki 305-8686, Japan (Xu); and the National Institute of Agrobiological Sciences, Kannondai, Tsukuba, Ibaraki 305-8602, Japan (Komatsuda). Stephen M. Githiri is now at the Department of Crop Science, University of Nairobi, PO Box 30197, Nairobi, Kenya; and Daijun Yang is now at the Agriculture and Agri-Food Canada, Saskatoon Research Centre, Saskatoon S7N 0X2, Canada
Address correspondence to R. Takahashi at the address above, or e-mail: masako{at}affrc.go.jp.
Exposure of soybean [Glycine max (L.) Merr.] to chilling temperatures at flowering stage induces browning around the hilum of the seed coats. The brown pigmentation spoils the external appearance of soybean seeds and reduces their commercial value. Our previous studies revealed that pigmentation was controlled by a few major genes, and one of the genes is closely associated with a maturity gene. This study was conducted to further investigate inheritance of pigmentation using DNA markers. Fifty-eight F2 plants derived from a cross between a tolerant cv. Koganejiro and a sensitive cv. Kitakomachi were exposed to 15 °C for 2 weeks beginning 8 days after anthesis. Genotypes of 522 genetic markers were determined using the F2 plants. Composite interval mapping revealed 5 quantitative trait loci (QTLs) for pigmentation, pig1 to pig5 (pig1 in molecular linkage group A2 [MLG A2], pig2 in MLG B1, pig3 in MLG C2, pig4 in molecular linkage group (MLG), and pig5 in MLG N) and 4 QTLs for flowering date, fd1 to fd4 (fd1 in MLG C1, fd2 in MLG C2, fd3 in MLG J, and fd4 in MLG L). Based on the relative location with markers, fd2 and fd4 probably correspond to E1 and E3, respectively. pig3 and fd2 were found at a similar position, and logarithm of odds (LOD) score plots for pigmentation and flowering date almost overlapped around this region. Considering the fact that pig3 had the most intense effects on pigmentation, E1 is presumed to be the maturity gene that profoundly affects pigmentation. Further, E3 has a small effect on pigmentation in accordance with the previous reports. These results support the idea that soybean maturity genes control low temperatureinduced pigmentation with various intensities specific to each maturity gene. QTLs for seed coat pigmentation with small or no impact on maturity identified in this study may be useful in breeding for chilling tolerance.
Chilling temperatures (about 15 °C) during flowering of soybean [Glycine max (L.) Merr.] induce browning and cracking of the seed coats (Sunada and Ito 1982). Both pigmentation and cracking spoils the external appearance of soybean seeds and reduce their commercial value. Seed coat pigmentation occurs only in yellow hilum cultivars (Sunada and Ito 1982). Using near-isogenic lines (NILS), Takahashi and Asanuma (1996) found that tolerance of brown hilum cultivars to pigmentation is derived from T gene responsible for pubescence color (tawny pubescence).
Further, there is genetic variation in the tolerance to pigmentation among cultivars with yellow hilum and gray pubescence. Takahashi and Abe (1994) performed genetic analysis using F1 hybrids between a chilling temperature sensitive cv. Kitakomachi and a tolerant cv. Koganejiro, and their F2 population revealed that susceptibility was partially dominant to tolerance as a whole, and 1 or 2 major genes were involved in tolerance. However, progeny of tolerant F2 plants produced F3 lines fixed for tolerance and F3 lines segregating for tolerance (Takahashi and Abe 1999). Takahashi and Abe (1994) further found that one of the genes for tolerance was closely associated with a dominant gene for late maturity, the recessive allele of which was involved in floral induction under artificially induced long days by means of incandescent lamps (ILD).
Eight loci have been reported to control time to flowering and maturity in soybean: E1 and E2 (Bernard 1971), E3 (Buzzell 1971), E4 (Buzzell and Voldeng 1980), E5 (McBlain and Bernard 1987), E7 (Cober and Voldeng 2001), and E6 (Bonato and Vello 1999) and J (Ray et al. 1995) for long juvenility. Of these loci, E3 and E4 are involved in the response of flowering to long day length. The e3 locus controls the insensitivity to fluorescent long day length obtained by extending natural day length to 20 h using cool white fluorescent lamps with a high R:FR (red-to far-red-quantum) ratio. On the other hand, e4 combines with e3 to control the insensitivity to ILD obtained by extending natural day length to 20 h using ILD with a low R:FR ratio (Buzzell 1971; Buzzell and Voldeng 1980). E7 also was reported to be involved in ILD insensitivity (Cober and Voldeng 2001). Further, E1 markedly retards flowering under ILD relative to e1, when combined with e3 and e4 (Cober et al. 1996).
Takahashi and Abe (1999) treated soybean cv. Harosoy (e1e1 e2e2 E3E3 E4E4 e5 e5 E7E7) and its near isogenic lines (NILs) for E1E5 loci with 15 °C. Intensity of pigmentation was not affected by e3, was slightly reduced by E2 and e4, but it was profoundly reduced by E1 and E5. Benitez et al. (2004) found that dominant allele of E7 locus also had an inhibitory effect. Based on ILD insensitivity and intensity of effect on pigmentation, Takahashi and Abe (1999) presumed that E1 is the most likely candidate for a maturity gene associated with pigmentation. This study was conducted to further investigate the inheritance of low temperatureinduced seed coat browning using DNA markers.
| Materials and Methods |
|---|
|
|
|---|
Plant Materials
Two cultivars with yellow seed coat and hilum (II tt rr W1W1), Kitakomachi and Koganejiro were used. Kitakomachi, a determinate type (Dt1Dt1 Dt2Dt2) with ovate leaflets (LnLn), is sensitive to low temperatures (severely pigmented), whereas Koganejiro, a semideterminate type (Dt1Dt1Dt2Dt2) with narrow leaflets (lnln), is tolerant (slightly pigmented). Both cultivars were developed at Tokachi Agricultural Experimental Station and are adapted to the Hokkaido region (northern Japan) (Figure 1). Seeds were planted on 16 June 1998 at the National Institute of Crop Science, Tsukuba, Japan (36°06'N, 140°05'E). Ten plants for each parent and 58 F2 plants were individually grown in pots as previously described (Takahashi and Abe 1994).
|
Low-Temperature Treatment
Low-temperature treatment was carried out by transferring potted plants from the greenhouse to a phytotron set at 15 °C. Light was supplied at a photosynthetic photon flux density (400700 nm) of 250 µE m2 s1 using metal halide lamps (DR 400/T(L), Toshiba, Tokyo, Japan) at a 14:10 h light:dark regime in the phytotron. Because earlier studies revealed that pigmentation due to chilling is most intense when flowers from 5 to 10 days after opening of individual flowers (DAO) were exposed to 15 °C treatment for more than 10 days, plants were exposed to chilling for 2 weeks beginning 8 days after anthesis of individual plants. Pots were distributed at random both in the phytotron and the greenhouse and repositioned twice a week in the greenhouse and daily in the phytotron. Because flowering period in soybean spans over 2 weeks, chilling treatment of an individual plant leads to exposure of flowers at various stages of development. Accordingly, flowers were individually labeled with the date of opening, and only the flowers that opened before the beginning of chilling treatment were used for analysis. Flowers that opened at 1 and 6 days after anthesis of individual plants were subjected to chilling stress from 7 and 2 DAO, respectively. After 2 weeks of chilling treatment, pots were returned to the greenhouse. The degree of pigmentation of each seed was visually classified using a pigmentation index (0 = not pigmented to 4 = severely pigmented) as previously described (Takahashi 1997).
Morphological Markers and RAPD Analysis
Genotypes at morphological markers, Ln and Dt1, among the F2 plants were visually scored. Total DNA of parents and F2 plants was extracted from trifoliolate leaves by cetyl trimethyl ammonium bromide (CTAB) method (Murray and Thompson 1980). random amplified polymorphic DNA (RAPD) analysis followed Ferreira et al. (2000) using 8 primers previously mapped in the soybean molecular linkage group (Shoemaker and Olsen 1993).
SSR Analysis
A total of 1147 pairs of simple sequence repeat (SSR) primers developed by US Department of Agriculture (Cregan et al. 1999; Song et al. 2004) and Chiba University (Harada K, personal communication) were used for screening of the parents. The polymerase chain reaction (PCR) mixture contained 30 ng of genomic DNA, 5 nmol of primer, 10 pmol of nucleotides, and 1 unit of ExTaq in 1x ExTaq buffer supplied by the manufacturer (TAKARA BIO, Ohtsu, Japan) in a total volume of 50 µl. After an initial 30 s denaturation at 94 °C, there were 30 cycles of 30 s denaturation at 94 °C, 1 min annealing at 60 °C, and 1 min extension at 72 °C. A final 7 min extension at 72 °C completed the program. The PCR was performed in an Applied Biosystems 9700 thermal cycler (Applied Biosystems, Foster City, CA). The PCR products were separated on 8% nondenaturing acrylamide gels (39:1), and the fragments were visualized by ethidium bromide staining. For analysis of SSR loci with small size differences, forward primers were labeled with blue (FAM), green (TET), or yellow (HEX) fluorescent tags and subjected to automated DNA sizing technologies (Ziegle et al. 1992). After amplification, 1.5 µl of FAM-labeled, 2.0 µl of TET-labeled, and 4.0 µl of HEX-labeled PCR products were combined and brought to a total volume of 20 µl by adding distilled water. The sample of the combined PCR products was loaded and separated on an Applied Biosystems 377A DNA sequencer. GeneScan 672 software (Applied Biosystems) was used to score the band polymorphism.
AFLP Analysis
Amplified fragment length polymorphism (AFLP) analysis was performed using a total of 1024 primer pairs according to Mano et al. (2001). PCR reactions were performed with EcoRI- and MseI-digested DNA ligated to 2 sets of primers using ExTaq. PCR products were separated on 7% denaturing acrylamide gels (38:2), and the fragments were visualized by silver staining using a Sil-Best staining kit (Nacalai Tesque, Kyoto, Japan).
Cleaved Amplified Polymorphic Sequence Analysis
Based on the cDNA sequence of soybean Kunitz trypsin inhibitor gene (GenBank accession number: X64448), forward (ATGAAGAGCACCATCTTCTTTG) and reverse primers (TCACTCACTGCGAGAAAGGC) were constructed to amplify the entire coding region (654 bp). PCR profile was similar to SSR analysis except that annealing was performed at 63 °C. PCR products were digested with HaeIII and separated by 8% nondenaturing acrylamide gels.
Linkage Mapping and QTL Analysis
The observed segregation ratios of morphological and molecular markers were tested by chi-square analyses. Unstable or weak markers were eliminated. A linkage map was constructed using MapMaker/EXP ver. 3.0 (Lander et al. 1987) with the threshold LOD score of 3.0. QTL analysis was performed by composite interval mapping (Zeng 1993) using the QTL Cartographer version 2.0 (Basten et al. 2001) with the threshold LOD value of 3.0.
| Results and Discussion |
|---|
|
|
|---|
Seed Coat Pigmentation
Similar to our previous report (Takahashi and Abe 1994), pigmentation index was dependent on the developmental stage of flowers at the beginning of chilling treatment (Figure 2). Pigmentation index in Kitakomachi was low between 0 and 3 DAO but it increased thereafter. In contrast, pigmentation index in Koganejiro increased from 2 to 4 DAO and decreased thereafter. Varietal differences in pigmentation index between the parents were evident in flowers exposed to chilling temperatures from 5 to 8 DAO. Accordingly, pigmentation index of individual plants (average pigmentation index [API]) was calculated by averaging the pigmentation index of seeds derived from flowers exposed to chilling temperatures during 58 DAO. On average, seeds originated from 6 pods for each F2 plant were evaluated for QTL analysis. Mean ± standard deviation (SD) of API and flowering date for the parents and the F2 population was presented in Table 1. Varietal differences in API were evident, whereas flowering date differed only by 2 days. API negatively correlated with flowering date (r = 0.86**) in accordance with our previous report (Takahashi and Abe 1994).
|
|
Polymorphism of Markers and Linkage Mapping
HaeIII treatment of the PCR product corresponding to trypsin inhibitor gene produced 2 bands in Koganejiro, whereas no digestion was observed in Kitakomachi. The CAPS marker was used for linkage mapping. A total of 522 markers including 5 RAPD, 184 SSR, 330 AFLP, 2 morphological markers, and 1 CAPS marker exhibited distinct separation in the F2 population and were used for linkage mapping. Among the 522 markers, 491 markers were linked and they comprised 31 linkage groups containing 20 known linkage groups. On average, 21 markers were placed in each linkage group. The total map coverage excluding unlinked markers was 2656 cM with an average of 5.4 cM between loci. MLG A1 and F contained only 2 (ranging 12.8 cM) and 6 markers (ranging 20.0 cM), respectively. Lack of polymorphisms in such regions in this population may be due to the shared pedigree of the parents. A high-yielding cultivar, Tokachinagaha, was widely used as a parent in soybean breeding in Hokkaido. Tokachinagaha was used as a parent one generation prior to Koganejiro and 3 generations prior to Kitakomachi (Figure 1). Thus, 50 and 12.5% of genomic regions are presumed to be derived from Tokachinagaha in Koganejiro and Kitakomachi, respectively. However, considering the large number of markers used in this study, most of the polymorphic regions between the parents could be surveyed for existence of QTLs.
QTL Analysis
Composite interval mapping revealed 5 QTLs, pig1 to pig5 (pig1 in MLG A2, pig2 in MLG B1, pig3 in MLG C2, pig4 in MLG J, and pig5 in MLG N) for API (Table 2 and Figure 3). The LOD score of pig3 was highest (7.01), and it explained 36.7% of the total variance. Additive effects indicated that Koganejiro genotypes at markers around pig3 reduced API, whereas they increased API around the other QTLs. The results suggested a complex inheritance of tolerance to low temperatureinduced pigmentation in accordance with the previous report (Takahashi and Abe 1994).
|
|
Composite interval mapping revealed 4 QTLs, fd1 to fd4 (fd1 in MLG C1, fd2 in MLG C2, fd3 in MLG J, and fd4 in MLG L) for flowering date (Table 2 and Figure 3). The LOD score of fd2 was highest (5.99), and it explained 24.6% of the total variance. Additive effects indicated that Koganejiro genotypes at markers around fd3 increased the number of days to flowering, whereas they reduced the number of days to flowering around the other QTLs. Based on the relative location with markers, fd2 and fd4 were presumed to correspond to E1 and E3, respectively (Cregan et al. 1999).
The QTLs for API and flowering date having the highest LOD scores (pig3 and fd2) were found at a similar position in MLG C2 (Figure 3). To further investigate the association between API and flowering date, LOD scores for API and flowering date were plotted around the QTLs detected in this study (Figure 4). The LOD score plots around pig3 and fd2 almost overlapped. A small LOD score peak for flowering date was observed at a similar position with pig2 and pig5, and a small peak for API was found at a similar position with fd1 and fd4. In contrast, pig1 and pig4 exhibited no direct association with days to flowering.
|
These results confirm the hypothesis of Takahashi and Abe (1999) that a maturity gene having a drastic effect on pigmentation in the F2 population might correspond to E1. The E1 allele probably delayed flowering date and reduced API in the F2 population. Further, the effect of E3 on seed coat pigmentation was small in consistent with the reports of Takahashi and Abe (1999) and Benitez et al. (2004). They also reported that among maturity genes E1E5 and E7, only E4 reduced the degree of pigmentation and cracking due to its recessive allele. These results support the idea that maturity genes control low temperatureinduced seed coat pigmentation at various intensities and directions specific to each maturity gene. Probably, identical pathways are shared in the control of both transition from vegetative to reproductive growth and low temperatureinduced seed coat pigmentation. Molecular cloning and characterization of maturity genes may provide further insight into the mechanism of low-temperature response in soybean.
Soybean breeders at high latitude regions require early maturing cultivars that produce seeds with satisfactory commercial quality. Early maturity is indispensable in soybean cultivars to achieve sufficient seed yield at high latitude regions with short growing season. However, alleles for early maturity reduce chilling tolerance in terms of seed quality except for E4. One resolution to this problem is to choose an appropriate combination of alleles at the maturity loci. Benitez et al. (2004) and Takahashi et al. (2005) revealed that effects of E1, E3, E4, and E7 on low temperatureinduced seed coat deterioration were additive and the combination effects of maturity genes could roughly be estimated by individual gene actions. Takahashi et al. (2005) further found that an appropriate combination of maturity loci improved chilling tolerance in terms of yield as well as quality of soybean seeds under low-temperature conditions. The second option is to utilize QTLs for tolerance to seed coat pigmentation with small or no impact on maturity including candidate regions identified in this study.
Effects of maturity genes were consistent with previous studies, suggesting reliability of plant treatments and validity of QTL analysis. However, Beavis (1994) reported that when sample size is small in QTL analysis, statistical power of detecting a small QTL was low and the estimated effects were overestimated (Beavis effect). Considering the small population size used in this study, repetition of experiments may be necessary to find all existing QTLs and to determine the exact magnitude of QTL effects.
| Funding |
|---|
|
|
|---|
The Ministry of Agriculture, Forestry, and Fisheries of Japan to Green Technology Project DM-1203; the Postdoctoral Fellowship for Foreign Researchers from the Japan Society for the Promotion of Science to S.M.G.; and the Japanese Government (MEXT) Scholarship to N.A.K.
| Acknowledgments |
|---|
The authors are grateful to Dr K. Harada (Chiba University) for providing SSR primers and advice and Dr Joseph G. Dubouzet (National Institute of Agrobiological Sciences) for critical reading of the manuscript.
| Footnotes |
|---|
Corresponding Editor: Reid Palmer
Received December 18, 2006
Accepted April 7, 2007
| References |
|---|
|
|
|---|
-
Basten CJ, Weir BS, Zeng ZB. QTL Cartographer, Version 2.0 (2001) Raleigh (NC): Department of Statistics, North Carolina State University.
Beavis WD. The power and deceits of QTL experiments: lessons from comparative QTL studies. 49th Annual Corn and Sorghum Research Conference. (1994) Washington (DC): American Seed Trade Association. 252268.
Benitez ER, Funatsuki H, Kaneko Y, Matsuzawa Y, Bang SW, Takahashi R. Soybean maturity gene effects on seed coat pigmentation and cracking in response to low temperatures. Crop Sci (2004) 44:20382042.
Bernard RL. Two genes for time of flowering in soybeans. Crop Sci (1971) 11:242244.
Bonato ER, Vello NA. E6, a dominant gene conditioning early flowering and maturity in soybeans. Genet Mol Biol (1999) 22:229232.
Buzzell RI. Inheritance of a soybean flowering response to fluorescent-daylength conditions. Can J Cytol (1971) 13:703707.
Buzzell RI, Voldeng HD. Inheritance of insensitivity to long daylength. Soybean Genet Newsl (1980) 7:2629.
Cober ER, Tanner JM, Voldeng HD. Genetic control of photoperiod response in early-maturing, near-isogenic soybean lines. Crop Sci (1996) 36:601605.
Cober ER, Voldeng HD. A new soybean maturity and photoperiod-sensitivity locus linked to E1 and T. Crop Sci (2001) 41:698701.
Cregan PB, Jarvic T, Bush AL, Shoemaker RC, Lark KG, Kahler AL, Kaya N, VanToai TT, Lohnes DG, Chung J, et al. An integrated genetic map of the soybean genome. Crop Sci (1999) 39:14641490.
Ferreira AR, Foutz KR, Keim P. Soybean genetic map of RAPD markers assigned to an existing scaffold RFLP map. J Hered (2000) 91:392396.
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE, Newburg L. Mapmaker: an interactive computer package for constructing primary genetic linkage map of experimental and natural populations. Genomics (1987) 1:174181.[CrossRef][Medline]
Mano Y, Kawasaki S, Takaiwa F, Komatsuda T. Construction of a genetic map of barley (Hordeum vulgare L.) cross Azumamugi x Kanto Nakate Gold using a simple and efficient amplified fragment-length polymorphism system. Genome (2001) 44:284292.[Medline]
McBlain BA, Bernard RL. A new gene affecting the time of flowering and maturity in soybean. J Hered (1987) 78:160162.
Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucl Acid Res (1980) 8:43214325.
Ray JD, Hinson K, Manjono JEB, Malo MF. Genetic control of long-juvenile trait in soybean. Crop Sci (1995) 35:10011006.
Shoemaker RC, Olsen TC. Molecular linkage map of soybean (Glycine max L. Merr.). In: Genetic maps: locus maps of complex genomesO'Brien SJ, ed. (1993) Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press. 6.1316.156.
Song QJ, Marek LF, Shoemaker RC, Lark KG, Concibido VC, Delannay X, Specht JE, Cregan PB. A new integrated genetic linkage map of the soybean. Theor Appl Genet (2004) 109:122128.[CrossRef][ISI][Medline]
Sunada K, Ito T. Soybean grain quality as affected by low temperature treatments in plants (color of hilum, seed coat cracking). (1982) Rep Hokkaido Branch, Crop Sci Soc Jpn and Hokkaido Branch, Jpn Soc Breeding. 22:34. Japanese.
Takahashi R. Association of soybean genes I and T with low-temperature induced seed coat deterioration. Crop Sci (1997) 37:17551759.
Takahashi R, Abe J. Genetic and linkage analysis of low temperature-induced browning in soybean seed coats. J Hered (1994) 85:447450.
Takahashi R, Abe J. Soybean maturity genes associated with seed coat pigmentation and cracking in response to low temperatures. Crop Sci (1999) 39:16571662.
Takahashi R, Asanuma S. Association of T gene with chilling tolerance in soybean. Crop Sci (1996) 36:559562.
Takahashi R, Benitez ER, Funatsuki H, Ohnishi S. Soybean maturity and pubescence color genes improve chilling tolerance. Crop Sci (2005) 45:13871393.
Zeng ZB. Theoretical basis for separation of multiple linked gene effects in mapping quantitative trait loci. Proc Natl Acad Sci USA (1993) 90:1097210976.
Ziegle JS, Su Y, Corcoran KP, Nie L, Mayrand PE, Hoff LB. Application of automated DNA sizing technology for genotype microsatellite loci. Genomics (1992) 14:10261031.[CrossRef][ISI][Medline]
This article has been cited by other articles:
![]() |
H. Matsumura, B. Liu, J. Abe, and R. Takahashi AFLP Mapping of Soybean Maturity Gene E4 J. Hered., March 1, 2008; 99(2): 193 - 197. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




