Skip Navigation



Journal of Heredity Advance Access published online on August 22, 2008

Journal of Heredity, doi:10.1093/jhered/esn062
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
99/6/661    most recent
esn062v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Slewinski, T. L.
Right arrow Articles by Braun, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Slewinski, T. L.
Right arrow Articles by Braun, D. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The American Genetic Association. 2008. All rights reserved. For permissions, please email: journals.permissions@oxfordjournals.org.

Brief Communications

Determining the Role of Tie-dyed1 in Starch Metabolism: Epistasis Analysis with a Maize ADP-Glucose Pyrophosphorylase Mutant Lacking Leaf Starch

Thomas L. Slewinski, Yi Ma, R. Frank Baker, Mingshu Huang, Robert Meeley, and David M. Braun

From the Department of Biology, 208 Mueller Lab, Pennsylvania State University, University Park, PA 16802 (Slewinski, Ma, Baker, Huang, and Braun) and Pioneer Hi-Bred International Incorporated, Johnston, IA 50131 (Meeley)

Address correspondence to David M. Braun at the address above, or e-mail: dbraun{at}psu.edu.

In regions of their leaves, tdy1-R mutants hyperaccumulate starch. We propose 2 alternative hypotheses to account for the data, that Tdy1 functions in starch catabolism or that Tdy1 promotes sucrose export from leaves. To determine whether Tdy1 might function in starch breakdown, we exposed plants to extended darkness. We found that the tdy1-R mutant leaves retain large amounts of starch on prolonged dark treatment, consistent with a defect in starch catabolism. To further test this hypothesis, we identified a mutant allele of the leaf expressed small subunit of ADP-glucose pyrophosphorylase (agps-m1), an enzyme required for starch synthesis. We determined that the agps-m1 mutant allele is a molecular null and that plants homozygous for the mutation lack transitory leaf starch. Epistasis analysis of tdy1-R; agps-m1 double mutants demonstrates that Tdy1 function is independent of starch metabolism. These data suggest that Tdy1 may function in sucrose export from leaves.

Key Words: ADP-glucose pyrophosphorylasemaizeTie-dyed1


Carbon partitioning is the process whereby photoassimilates are allocated from their site of synthesis in leaves to the rest of the plant. As photoassimilates accumulate in leaves during daylight, excess carbon is temporarily stored as transitory starch in the chloroplasts (Dinges et al. 2003; Lu and Sharkey 2006; Zeeman et al. 2007). In maize (Zea mays), transitory starch occurs almost entirely in the bundle sheath chloroplasts (Rhoades and Carvalho 1944). The first committed step in starch synthesis is catalyzed by ADP-glucose pyrophosphorylase (AGPase) (James et al. 2003; Hannah 2005). AGPase is a heterotetrameric enzyme composed of 2 small and 2 large subunits (James et al. 2003; Hannah 2005; Georgelis et al. 2007). Mutations in principally leaf expressed genes encoding AGPase result in reduced or no transitory starch synthesis (Lin et al. 1988a, 1988b; Wang et al. 1998; Rosti et al. 2006; Lee et al. 2007; Rosti et al. 2007). Conversely, mutations in genes functioning in transitory starch catabolism result in excess starch accumulation in leaves (Zeeman et al. 1998; Blauth et al. 2001; Critchley et al. 2001; Yu et al. 2001; Dinges et al. 2003; Chia et al. 2004; Lu and Sharkey 2004; Niittyla et al. 2004). Most of these mutants display reduced growth and delayed flowering presumably due to decreased transport of assimilates to the growing sink tissues and in some cases exhibit leaf chlorosis.

To understand the genetic control of carbon partitioning, we are characterizing maize mutants that hyperaccumulate carbohydrates in their leaves. A variegated, recessive mutant, tie-dyed1-Reference (tdy1-R) contains ~16-fold higher starch and ~3- to 10-fold higher soluble sugar levels in chlorotic leaf regions relative to wild type (Figure 1A–D) (Braun et al. 2006). The tdy1-R mutants also show reduced growth and delayed flowering likely due to the retention of carbohydrates within the leaves (Braun et al. 2006). Through a genetic mosaic analysis, we localized the site of Tdy1 function to the innermost tissue layer of leaves containing the interveinal mesophyll, bundle sheath, and vascular cells (Baker and Braun 2007). One hypothesis for Tdy1 function is that it controls sucrose export into the veins (Braun et al. 2006). If tdy1-R mutants have reduced sucrose export capacity, soluble sugars would accumulate in mutant leaves and result in greater amounts of carbon being partitioned to starch. However, an alternative hypothesis is that Tdy1 functions in the starch catabolism pathway in the photosynthetic cells. In this case, in tdy1-R mutant leaves, reduced starch degradation activity would produce the observed overaccumulation of starch. Sugars would then presumably hyperaccumulate due to feedback inhibition of starch synthesis in the chloroplasts.


Figure 1
View larger version (71K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Excess starch is retained in tdy1-R chlorotic leaf regions after prolonged dark exposure. (A, B, E, and F) show wild-type leaves; (C, D, G, and H) show tdy1-R leaves. (A, C, E, and G) are leaf photographs; (B, D, F, and H) show the same leaves, cleared of photosynthetic pigments and starch stained with IKI. (AD) Leaves collected at the end of the day; (EH) leaves collected after 72 h of darkness. Note that the leaf in (B) was stained longer than the leaf in (D) to demonstrate starch in wild type. The leaves in (F) and (H) were stained equivalently. In (C) and (G), the anthocyanin accumulation within tdy1-R chlorotic regions is likely induced in response to osmotic stress (Chalker-Scott 1999; Braun et al. 2006).

 
In this report, we distinguish between these hypotheses. To do so, we characterize a maize mutation in the gene encoding the leaf expressed small subunit of AGPase. Both the large and small subunits of AGPase are encoded by small gene families in maize with different members showing overlapping but preferential expression within a tissue (Giroux and Hannah 1994; Prioul et al. 1994; Giroux et al. 1995; Hannah et al. 2001; Georgelis et al. 2007; Rosti and Denyer 2007; Cossegal et al. 2008). In maize leaves, the predominantly expressed small subunit gene is Agpslzm (Prioul et al. 1994; Hannah et al. 2001; Rosti and Denyer 2007; Cossegal et al. 2008). Here, we show that plants homozygous for a mutation in Agpslzm (agps-m1) lack leaf transitory starch synthesis. Furthermore, we utilize this mutant to test the hypothesized function of Tdy1 in starch metabolism.


    Materials and Methods
 Top
 Materials and Methods
 Results and Discussion
 Funding
 References
 
Plant Growth Conditions and Genetic Materials
Plants were grown in the summer nursery in the Rock Springs Agronomy Farm, Pennsylvania State University. For the dark shift experiment, plants were initially grown in a greenhouse supplemented with sodium vapor and metal halide lamps under a 12-h day (30 °C)/12-h night (20 °C) prior to being moved into a dark room maintained at 25 °C. The tdy1-R allele introgressed into B73 has been described (Braun et al. 2006). The agps-m1 allele was isolated using the Trait Utility System for Corn (TUSC, Pioneer Hi-Bred International, Johnston, IA) (Bensen et al. 1995). Plants containing the agps-m1 allele were outcrossed to Mu Killer (Slotkin et al. 2003; Slotkin et al. 2005) to silence Mu activity and then introgressed three times into the B73 genetic background prior to analyses. Plants carrying the agps-m1 allele were identified by polymerase chain reaction (PCR) genotyping using an Agpslzm primer GTACAATCTAGTCCCAGCACCACC and a primer designed to the terminal inverted repeat of Mu elements AACGCCTCCATTTCGTCGAATCC with PCR conditions of 94 °C 30 s, 60 °C 30 s, 72 °C 30 s for 35 cycles. The wild-type Agpslzm allele was genotyped using the above gene primer with a second Agpslzm primer GCTTGCCTCTGATCCGTCGGGTTG using the same PCR conditions except with a 45-s extension time. Plants from F2 families segregating agps-m1 and tdy1-R were PCR genotyped for Agpslzm and agps-m1 and were visually scored for the tdy1-R variegated leaf phenotype. Plants scored as homozygous for agps-m1 were confirmed to lack leaf starch by starch staining.

Morphometric and Biochemical Analyses
Iodine–potassium iodide (IKI) staining of leaf starch, soluble sugars, and chlorophyll quantifications and morphological analyses were done as described in Braun et al. (2006), Baker and Braun (2007), Baker and Braun (2008), and Ma et al. (2008). For leaf number, plant height, days to flowering, and ear length n = 7–14 plants; for chlorophyll content n = 30; for total kernel number per ear n = 12; and kernel weight is the average of 100 kernels per ear from n = 10. Sugar content was determined from adult leaves of greenhouse grown plants collected at the end of the day. For tdy1-R single mutant and tdy1-R; agps-m1 leaves, chlorotic regions were assayed. The in-gel AGPase activity assay was performed according to Wang et al. (1998). After detecting AGPase activity, the gel was fixed and stained with Coomassie Blue followed by destaining with ethanol/acetic acid to visualize equal protein loading.

Expression Analyses
RNA was isolated from mature leaves of field grown plants using the RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) and cDNA synthesized with the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) according to the manufacturers' instructions. The PCR primer sequences used to monitor expression of Agpslzm were CGGACGGCGCGGCCGGGCGA and GCTCTTGAGAGGTGACGGTTGAG. The PCR conditions were 95 °C 15 s, 60 °C 15 s, and 72 °C 15 s for 35 cycles with a final concentration of 5% dimetihyl sulfoxide (DMSO) and 1.5% glycerol in the reaction. The PCR primer sequences for glyceraldehyde 3 phosphate dehydrogenase (GAPDH) were AGATCAAGATCGGAATCAACG and GAAGCGTCTTGGAGTCCTTGA. The PCR conditions were as above omitting the DMSO and glycerol.


    Results and Discussion
 Top
 Materials and Methods
 Results and Discussion
 Funding
 References
 
One possibility to account for the elevated starch levels observed in tdy1-R leaves is that Tdy1 functions to promote starch turn over. To test if tdy1-R had altered starch breakdown, we exposed wild-type and tdy1-R mutant plants to extended periods of darkness and stained leaves with IKI to monitor starch depletion. After 24 h of darkness, wild-type leaves contained only a trace amount of starch indicating that the great majority of starch was metabolized, whereas tdy1-R mutant leaves had high levels of starch (data not shown). After 72 h of darkness, wild-type leaves were completely devoid of starch, yet tdy1-R mutants still contained high starch levels (Figure 1E–H). Hence, even after 3 days without photosynthesis, tdy1-R mutants retained abundant starch in their leaves. These data are consistent with the hypothesis that Tdy1 could function in transitory starch breakdown.

To distinguish between the 2 hypothesized functions of Tdy1, we identified a maize mutant unable to synthesize transitory starch. If Tdy1 functions in starch catabolism, we reasoned that plants lacking leaf starch would have no substrate for TDY1 to act on (directly or indirectly). Therefore, placing tdy1-R in a genetic background lacking leaf starch is predicted to suppress the tdy1-R phenotype. Conversely, if Tdy1 functions in sucrose export, starch synthesis mutants should show no effect on tdy1-R phenotypic expression. To identify mutations in Agpslzm and thereby potentially generate plants without leaf starch, we utilized TUSC to isolate a Mutator (Mu) transposable element insertion into Agpslzm (Figure 2A). We recovered a Mu1 transposon inserted into the first intron and refer to the mutant allele as agpslzm-m1::Mu1, here abbreviated agps-m1.


Figure 2
View larger version (47K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Mutant characterization of agps-m1 and epistasis analysis with tdy1-R. (A) Model of 5' portion of agps-m1 allele showing Mu1 insertion in intron 1. Exons are shown as boxes, introns and 5' untranslated region are shown as lines (not drawn to scale). Arrows indicate locations of primers used for reverse transcription–PCR (RT-PCR). (B) RT-PCR shows wild-type leaves express Agpslzm but no RNA is detected in agps-m1 mutant leaves. Bottom panel shows expression of GAPDH in both wild-type and mutant leaves. In (B) and (C), wt, wild type and agps, agps-m1 mutant. (C) In-gel activity assay detects active AGPase in wild type but not in agps-m1 mutant leaf extracts. Bottom panel is the same gel after Coomassie Blue staining showing equal amounts of protein loaded per lane. (D, F, and H) Photograph of leaves collected at the end of the day. (E, G, and I) Corresponding leaves after IKI staining. (D, E) Wild type. (F, G) agps-m1. (H, I) tdy1-R; agps-m1 double mutant. The leaves in (E), (G), and (I) were stained equivalently.

 
Characterization of agps-m1 mutant plants demonstrated that the insertion eliminated gene function. Reverse transcription–PCR analysis on leaf RNA showed that although the Mu1 element inserted into an intron, no RNA was detected (Figure 2B). We confirmed the allele is a null by assessing the AGPase activity in wild-type and mutant leaf extracts and determined that the mutant produced no functional protein (Figure 2C). Wild-type leaf extracts produce 2 strong bands and a faster migrating weaker intensity band on the activity gels. All 3 forms are missing in the agps-m1 mutant extracts (Figure 2C), indicating that the small subunit function is required to produce all leaf isoforms. Lastly, we examined leaf starch accumulation at the end of the day by IKI staining and determined that agps-m1 mutant leaves lack starch (Figure 2D–G). Together, these analyses demonstrate that the Agpslzm gene provides the small subunit of AGPase responsible for transitory starch synthesis in maize leaves. This finding is consistent with a recent report suggesting that although an alternatively spliced RNA of the endosperm functioning small subunit of AGPase, Brittle2, is expressed in leaves, it does not appreciably contribute to the AGPase activity in leaves (Rosti and Denyer 2007).

Under field conditions, the growth of agps-m1 mutant plants may have slightly diminished vigor (Table 1). However, it was not significantly different from wild-type siblings, similar to descriptions of rice and barley AGPase mutants (Rosti et al. 2006; Lee et al. 2007; Rosti et al. 2007). This was a somewhat surprising finding because maize partitions a greater amount of carbon to starch than does rice or barley (Kalt-Torres et al. 1987; Hussain et al. 1999; Cairns et al. 2002). It is possible that in the field conditions in the summer nursery, sufficient sucrose is produced to compensate for the loss of carbon transiently stored as starch. In support of this idea, we found that sucrose levels in agps-m1 leaves were approximately twice that of wild type (Table 2). A similar observation was reported for a mutation in the maize leaf pullulanase enzyme (Dinges et al. 2003). In this case, the inability to completely degrade transitory starch at night resulted in a reduced synthesis of starch the following day and a greater partitioning of fixed carbon to sucrose, but no morphological phenotypes were evident (Dinges et al. 2003).


View this table:
[in this window]
[in a new window]

 
Table 1. Mutants of agps-m1 have normal growth

 


View this table:
[in this window]
[in a new window]

 
Table 2. Sugar quantification in wild type, single and double mutant leaves

 
To test the hypothesis that Tdy1 functions in starch catabolism, we analyzed tdy1-R; agps-m1 double mutant plants. If Tdy1 functioned in starch breakdown, we would expect agps-m1 mutants to suppress the tdy1-R phenotype. Instead, double mutant leaves were variegated and expressed the tdy1-R mutant phenotype (Figure 2H). IKI staining revealed that the double mutant leaves contained no detectable starch (Figure 2I). Furthermore, the soluble sugar levels in the double mutants were similar to the tdy1-R single mutants (Table 2). Thus, agps-m1 is not epistatic to tdy1-R. These data argue against the hypothesis that Tdy1 functions in starch breakdown because expression of the tdy1-R phenotype was independent of the presence or absence of starch. We interpret these data to support the conclusion that Tdy1 and Agpslzm function in independent pathways. Therefore, we favor the hypothesis that Tdy1 functions to promote the sucrose export capacity of leaves. Future work will test this hypothesis by characterizing the molecular function of TDY1 and determining its role in phloem transport.


    Funding
 Top
 Materials and Methods
 Results and Discussion
 Funding
 References
 
National Research Initiative of the United States Department of Agriculture Cooperative State Research, Education and Extension Service (2004-35304-14948 to D.M.B.)


    Acknowledgments
 
We thank Tony Omeis and Scott Harkcom for excellent plant care and Paula McSteen and Mark Guiltinan for comments on the manuscript. We appreciate the suggestions of Curt Hannah and 2 anonymous reviewers that improved the manuscript. Recipients requesting agps-m1 seed agree neither to use such materials for commercial purposes nor to transfer them to a third party without the consent of the donor.


    Footnotes
 
Corresponding Editor: Susan Gabay-Laughnan

Received April 21, 2008
Accepted July 21, 2008


    References
 Top
 Materials and Methods
 Results and Discussion
 Funding
 References
 

    Baker RF, Braun DM. tie-dyed1 functions non-cell autonomously to control carbohydrate accumulation in maize leaves. Plant Physiol. (2007) 144:867–878.[Abstract/Free Full Text]

    Baker RF, Braun DM. tie-dyed2 functions with tie-dyed1 to promote carbohydrate export from maize leaves. Plant Physiol. (2008) 146:1085–1097.[Abstract/Free Full Text]

    Bensen R, Johal G, Crane V, Tossberg J, Schnable P, Meeley R, Briggs S. Cloning and characterization of the maize An1 gene. Plant Cell (1995) 7:75–84.[Abstract]

    Blauth S, Yao Y, Klucinec J, Shannon J, Thompson D, Guilitinan M. Identification of Mutator insertional mutants of starch-branching enzyme 2a in corn. Plant Physiol. (2001) 125:1396–1405.[Abstract/Free Full Text]

    Braun DM, Ma Y, Inada N, Muszynski MG, Baker RF. tie-dyed1 regulates carbohydrate accumulation in maize leaves. Plant Physiol. (2006) 142:1511–1522.[Abstract/Free Full Text]

    Cairns AJ, Cookson A, Thomas BJ, Turner LB. Starch metabolism in the fructan-grasses: patterns of starch accumulation in excised leaves of Lolium temulentum L. J Plant Physiol. (2002) 159:293–305.[CrossRef][Web of Science]

    Chalker-Scott L. Environmental significance of anthocyanins in plant stress responses. Photochem Photobiol (1999) 70:1–9.[CrossRef][Web of Science]

    Chia T, Thorneycroft D, Chapple A, Messerli G, Chen J, Zeeman SC, Smith SM, Smith AM. A cytosolic glucosyltransferase is required for conversion of starch to sucrose in Arabidopsis leaves at night. Plant J. (2004) 37:853–863.[CrossRef][Web of Science][Medline]

    Cossegal M, Chambrier P, Mbelo S, Balzergue S, Martin-Magniette M-L, Moing A, Deborde C, Guyon V, Perez P, Rogowsky P. Transcriptional and metabolic adjustments in AGPase deficient bt2 maize kernels. Plant Physiol. (2008) 146:1553–1570.[Abstract/Free Full Text]

    Critchley JH, Zeeman SC, Takaha T, Smith AM, Smith SM. A critical role for disproportionating enzyme in starch breakdown is revealed by a knock-out mutation in Arabidopsis. Plant J. (2001) 26:89–100.[CrossRef][Web of Science][Medline]

    Dinges JR, Colleoni C, James MG, Myers AM. Mutational analysis of the pullulanase-type debranching enzyme of maize indicates multiple functions in starch metabolism. Plant Cell (2003) 15:666–680.[Abstract/Free Full Text]

    Georgelis N, Braun EL, Shaw JR, Hannah LC. The two AGPase subunits evolve at different rates in angiosperms, yet they are equally sensitive to activity-altering amino acid changes when expressed in bacteria. Plant Cell (2007) 19:1458–1472.[Abstract/Free Full Text]

    Giroux M, Hannah LC. ADP-glucose pyrophosphorylase in shrunken-2 and brittle-2 mutants of maize. Mol Gen Genet. (1994) 243:400–408.[Web of Science][Medline]

    Giroux M, Smith-White B, Gilmore V, Hannah LC, Preiss J. The large subunit of the embryo isoform of ADP glucose pyrophosphorylase from maize. Plant Physiol. (1995) 108:1333–1334.[CrossRef][Web of Science][Medline]

    Hannah LC. Starch synthesis in the maize endosperm. Maydica (2005) 50:497–506.

    Hannah LC, Shaw JR, Giroux MJ, Reyss A, Prioul J-L, Bae J-M, Lee J-Y. Maize genes encoding the small subunit of ADP-glucose pyrophosphorylase. Plant Physiol. (2001) 127:173–183.[Abstract/Free Full Text]

    Hussain MW, Hartwell Allen L Jr, Bowes G. Up-regulation of sucrose phosphate synthase in rice grown under elevated CO2 and temperature. Photosynth Res. (1999) 60:199–208.[CrossRef][Web of Science]

    James M, Denyer K, Myers A. Starch synthesis in the cereal endosperm. Curr Opin Plant Biol. (2003) 6:215–222.[CrossRef][Web of Science][Medline]

    Kalt-Torres W, Kerr PS, Usuda H, Huber SC. Diurnal changes in maize leaf photosynthesis: I. Carbon exchange rate, assimilate export rate, and enzyme activities. Plant Physiol. (1987) 83:283–288.[Abstract/Free Full Text]

    Lee S-K, Hwang S-K, Han M, Eom J-S, Kang H-G, Han Y, Choi S-B, Cho M-H, Bhoo S, An G, et al. Identification of the ADP-glucose pyrophosphorylase isoforms essential for starch synthesis in the leaf and seed endosperm of rice (Oryza sativa L.). Plant Mol Biol. (2007) 65:531–546.[Medline]

    Lin T, Caspar T, Somerville C, Preiss J. Isolation and characterization of a starchless mutant of Arabidopsis thaliana (L.) Heynh lacking ADPglucose pyrophosphorylase activity. Plant Physiol. (1988a) 86:1131–1135.[Abstract/Free Full Text]

    Lin T, Caspar T, Somerville C, Preiss J. A starch deficient mutant of Arabidopsis thaliana with low ADPglucose pyrophosphorylase activity lacks one of the two subunits of the enzyme. Plant Physiol. (1988b) 88:1175–1181.[Abstract/Free Full Text]

    Lu Y, Sharkey TD. The role of amylomaltase in maltose metabolism in the cytosol of photosynthetic cells. Planta (2004) 218:466–473.[CrossRef][Web of Science][Medline]

    Lu Y, Sharkey TD. The importance of maltose in transitory starch breakdown. Plant Cell Environ. (2006) 29:353–366.[CrossRef][Medline]

    Ma Y, Baker R, Magallanes-Lundback M, DellaPenna D, Braun D. Tie-dyed1 and Sucrose export defective1 act independently to promote carbohydrate export from maize leaves. Planta (2008) 227:527–538.[CrossRef][Medline]

    Niittyla T, Messerli G, Trevisan M, Chen J, Smith AM, Zeeman SC. A previously unknown maltose transporter essential for starch degradation in leaves. Science (2004) 303:87–89.[Abstract/Free Full Text]

    Prioul JL, Jeannette E, Reyss A, Gregory N, Giroux M, Hannah LC, Causse M. Expression of ADP-glucose pyrophosphorylase in maize (Zea mays L.) grain and source leaf during grain filling. Plant Physiol. (1994) 104:179–187.[Abstract]

    Rhoades M, Carvalho A. The function and structure of the parenchyma sheath plastids of the maize leaf. Bull Torrey Bot Club (1944) 71:335–346.[CrossRef]

    Rosti S, Denyer K. Two paralogous genes encoding small subunits of ADP-glucose pyrophosphorylase in maize, Bt2 and L2, replace the single alternatively spliced gene found in other cereal species. J Mol Evol. (2007) 65:316–327.[CrossRef][Web of Science][Medline]

    Rosti S, Fahy B, Denyer K. A mutant of rice lacking the leaf large subunit of ADP-glucose pyrophosphorylase has drastically reduced leaf starch content but grows normally. Funct Plant Biol. (2007) 34:480–489.[CrossRef]

    Rosti S, Rudi H, Rudi K, Opsahl-Sorteberg H-G, Fahy B, Denyer K. The gene encoding the cytosolic small subunit of ADP-glucose pyrophosphorylase in barley endosperm also encodes the major plastidial small subunit in the leaves. J Exp Bot. (2006) 57:3619–3626.[Abstract/Free Full Text]

    Slotkin RK, Freeling M, Lisch D. Mu Killer causes the heritable inactivation of the Mutator family of transposable elements in Zea mays. Genetics (2003) 165:781–797.[Abstract/Free Full Text]

    Slotkin RK, Freeling M, Lisch D. Heritable transposon silencing initiated by a naturally occurring transposon inverted duplication. Nat Genet. (2005) 37:641–644.[CrossRef][Web of Science][Medline]

    Wang S, Lue W, Yu T, Long J, Wang C, Eimert K, Chen J. Characterization of ADG1, an Arabidopsis locus encoding for ADPG pyrophosphorylase small subunit, demonstrates that the presence of the small subunit is required for large subunit stability. Plant J. (1998) 13:63–70.[CrossRef][Web of Science][Medline]

    Yu TS, Kofler H, Hausler RE, Hille D, Flugge UI, Zeeman SC, Smith AM, Kossmann J, Lloyd J, Ritte G, et al. The Arabidopsis sex1 mutant is defective in the R1 protein, a general regulator of starch degradation in plants, and not in the chloroplast hexose transporter. Plant Cell (2001) 13:1907–1918.[Abstract/Free Full Text]

    Zeeman S, Smith S, Smith A. The diurnal metabolism of leaf starch. Biochem J. (2007) 401:13–28.[CrossRef][Web of Science][Medline]

    Zeeman SC, Northrop F, Smith AM, Rees T. A starch-accumulating mutant of Arabidopsis thaliana deficient in a chloroplastic starch-hydrolysing enzyme. Plant J. (1998) 15:357–365.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol PlantHome page
M. Huang, T. L. Slewinski, R. F. Baker, D. Janick-Buckner, B. Buckner, G. S. Johal, and D. M. Braun
Camouflage Patterning in Maize Leaves Results from a Defect in Porphobilinogen Deaminase
Mol Plant, July 1, 2009; 2(4): 773 - 789.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
T. L. Slewinski, R. Meeley, and D. M. Braun
Sucrose transporter1 functions in phloem loading in maize leaves
J. Exp. Bot., March 1, 2009; 60(3): 881 - 892.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
D. M. Braun and T. L. Slewinski
Genetic Control of Carbon Partitioning in Grasses: Roles of Sucrose Transporters and Tie-dyed Loci in Phloem Loading
Plant Physiology, January 1, 2009; 149(1): 71 - 81.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
Y. Ma, T. L. Slewinski, R. F. Baker, and D. M. Braun
Tie-dyed1 Encodes a Novel, Phloem-Expressed Transmembrane Protein That Functions in Carbohydrate Partitioning
Plant Physiology, January 1, 2009; 149(1): 181 - 194.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
99/6/661    most recent
esn062v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Slewinski, T. L.
Right arrow Articles by Braun, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Slewinski, T. L.
Right arrow Articles by Braun, D. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?