Journal of Heredity Advance Access published online on September 16, 2008
Journal of Heredity, doi:10.1093/jhered/esn073
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Brief Communication |
Evolution and Differentiation of the Prion Protein Gene (PRNP) among Species
From the Department of Animal Science, College of Animal Science and Technology, Agricultural University of Hebei, Baoding 071001, China
Address correspondence to Li Xianglong at the address above, or e-mail: lixianglongcn{at}yahoo.com.
A total of 937 prion protein gene (PRNP) sequences belonging to 83 species in 56 genera of 26 families were analyzed in order to investigate its evolution and differentiation among species. The length of PRNP coding sequence for all species analyzed varied from 567 to 825 bp, which was mainly because of insertion or deletion in the repeat region within and among the species. TGA and TAG are the main stop codons in the PRNP gene. Bos taurus had the smallest variation in terms of average number of nucleotide differences (0.811), nucleotide diversity (0.0011), and nonsynonymous nucleotide diversity (0.0002) among all the ruminants. The reconstructed phylogenetic tree of PRNP of families and species was basically consistent with the taxonomy of National Center for Biotechnology Information except for Felidae (Felis catus), which was initially clustered with Moschidae rather than Mustelidae or Canidae.
Key Words: bovine spongiform encephalopathy interspecies comparison scrapie sequences TSEs
Transmissible spongiform encephalopathies (TSEs) are neurological diseases that are associated with the conversion of the normal host-encoded prion protein (PrP-sen) to an abnormal protease-resistant form (PrP-res). Interspecies infectivity of TSEs varies greatly (Prusiner and Scott 1997). Transmission of the TSE agent from one species to another is usually accompanied by a prolonged incubation time. Though sequence differences between the prion protein (PrP) of donor and recipient species play a role, the interspecies susceptibility is not simply determined by overall sequence similarity (Goldmann, Hunter, et al. 1996). TSEs have been identified in human, sheep, goat, deer, elk, moose, cattle, cat, and mink (Aguzzi and Sigurdson 2004), whereas rabbit appears to be resistant to infection by the TSE agent (Vorberg et al. 2003). Most of the reports on the prion protein gene (PRNP) are focused either on its variations and relationship with disease resistance or susceptibility within species (Goldmann et al. 1990; Westaway et al. 1994; Collinge et al. 1996; Goldmann, Martin, et al. 1996; O'Rourke et al. 1999, 2004; Billinis et al. 2002; Gombojav et al. 2003; Kurosaki et al. 2005; Meng et al. 2005; Acutis et al. 2006; Huson and Happ 2006; Johnson et al. 2006; Vaccari et al. 2006; Jeong et al. 2007) or on interspecific comparison of gene (genome) sequences (Khlebodarova et al. 1995; Lee et al. 1998; Wopfner et al. 1999; Premzl et al. 2004; Cotto et al. 2005; Premzl and Gamulin 2007). Little attention has been paid to the interspecific evolution of PRNP, except in sheep (Slate 2005) and an encoded protein comparison of 35 mammal species (van Rheede et al. 2003). In this study, we used taxon sampling with 83 species in 26 families including mammals, avians, amphibians, and fish. We focused on nucleotide variation in order to demonstrate molecular evolution of the analyzed species and to provide useful data for studying the relationship of nucleotide variation in interspecific prion protein transmission.
| Materials and Methods |
|---|
|
|
|---|
In this study, coding sequences (CDs) of PRNP in 83 species in 56 genera of 26 families were obtained from GenBank (see Table 1 Supplementary Material online). The taxon of each sequence was according to the National Center for Biotechnology Information (NCBI) taxonomy database.
All the sequences were aligned using BIOEDIT (version 7.0.8.0
[EC]
). Sequences of each species were first sorted into haplotypes using DNASP 4.0 software to avoid redundant sequences when the phylogenetic tree was reconstructed. DNASP 4.0 software was also used to analyze the polymorphic sites, the average number of nucleotide differences (k, Tajima 1983), number of haplotypes (h), synonymous nucleotide diversity [
(s)], nonsynonymous nucleotide diversity [
(a)], the number of total mutations (M), the number of nonsynonymous and synonymous polymorphic sites for each family N/S, and G + C content at the third codon position (GC3) for each stop codon usage. Estimates of the numbers of synonymous substitutions per synonymous site (dS) and nonsynonymous substitutions per nonsynonymous site (dN) between families were calculated with the modified Nei–Gojobori method (Zhang et al. 1998) using Jukes–Cantor correction and complete deletion of gaps using the Molecular Evolutionary Genetic Analysis (MEGA version 4.0) package (Tamura et al. 2007). A phylogenetic tree was reconstructed for haplotypes of all families, using the unweighted pair group method of analysis (UPGMA) based on dN between families. The gene tree of 83 species was also reconstructed using the UPGMA methods in MEGA using a phylogeny test through bootstrap analysis (1000 pseudoreplicates).
| Results and Discussion |
|---|
|
|
|---|
Sequence Length Variation within and among Species
The length of PRNP with complete CDS varies from 567 (Danio rerio) to 825 bp (Taeniopygia guttata) among all the analyzed species. In Bovidae, 4 types of length variants were found, of which 771 and 795 bp were the main length variant types. In the 794 sequences from Bovidae, 526 sequences from Capra hircus (22), Capra ibex (1), Ovis canadensis (10), Ovis aries (478), Ovis dalli (1), Rupicapra upicapra (1), Budorcas taxicolor (1), Ammotragus lervia (1), Bos taurus (6), Tragelaphus spekii (1), Kobus megaceros (1), Hippotragus niger (2), and Connochaetes taurinus (1) have a length of 771 bp. The 261 sequences from Bos (237), Tragelaphus (7), Bubalus (6), Bison (3), Syncerus (4), Boselaphus (2), Antilope (1), and Kobus (1) have 795 bp due to a 24-bp insertion of G(/A)CCT(/A)CATGGAGGT(/C)G(/A)GCTGGGGCC(/T)A from 210 to 233 bp. One sequence from B. Taurus has 747 bp because of a 24-bp deletion of GGAGGT(/C)GGCTGGGGTCAGCCCCAT from 217 to 240 bp (AY720672 [GenBank] ); 6 sequences from B. taurus have 819 bp found previously only in Brown Swiss cattle, due to two 24-bp insertions of C(/T)CAA(/G)CCT(/C)CATGGAGGTGGCTGGGG from 231 to 254 bp and TGGCTGGGGACAGCCACATGGTGG from 270 to 293 bp (AY720446 [GenBank] , AY720445 [GenBank] , AF455119 [GenBank] , AY720454 [GenBank] , AY720673 [GenBank] , and AY720674 [GenBank] ). Bovinae has a 24-bp insertion in contrast with Caprinae. The length variations in Bovidae, therefore, are due to one or two 24-bp nucleotide insertions or deletions. All the sequences (45) in Cervidae are 771 bp long.
Most species analyzed in Equidae have a PRNP coding region of 744 bp, but Equus asinus has 1 variation type (EF127815 [GenBank] ) caused by the stop codon mutation from TAA to TTC encoding phenylalanine and then a 24-bp elongation of CTCATTTTCCTCATAGTGGGCTGA encoding LIFLIVG after the stop codon mutation.
In Cercopithecidae, sequences from Cercopithecus aethiops (U08291 [GenBank] ) and Cercopithecus diana (U08292 [GenBank] ) are 738 bp due to a 24-bp deletion of CGGCTGGGGACAGCCTCATGGTGG encoding GWGQPHGG from 216 to 239 bp, whereas all species in Hominidae and Cercopithecidae have a 762-bp sequence.
Only Oryctolagus cuniculus was analyzed in Leporidae. Oryctolagus cuniculus had a deletion of TGG encoding glycine from 165 to 167 bp and GGT also encoding glycine from 283 to 285 bp (U28334 [GenBank] ); therefore, the length of PRNP varies from 759 to 765 bp. The length of PRNP in Camelus bactrianus of Camelidae, varying from 792 to 795 bp, is also due to a 3-bp deletion of CTC from 733 to 735 bp.
Gallus gallus, Pavo muticus, and Coturnix coturnix in Phasianidae were analyzed. Two sequences from G. gallus had different lengths of 822 and 804 bp. The 822-bp sequence (M95404 [GenBank] ) exists due to a 18-bp insertion of a duplication of TAACCCAGGGTACCCCCA, which had 3 copies in contrast with 2 copies in the 804-bp sequence (NM205465), from 198 to 215 bp encoding GYPHNP. The sequences from P. muticus (AY365065 [GenBank] ) and C. coturnix (AF256082 [GenBank] ) are 801 bp in length due to a 3-bp deletion of CTC from 778 to 780 bp. There are 2 length variants of 807 (BN000995 [GenBank] ) and 825 bp (BN000996 [GenBank] ) due to a 18-bp insertion of AGGGTACCCCCACAACCC from 258 to 275 bp in T. guttata of Estrildidae.
The mammalian PrP has several octapeptide repeats. The octapeptide repeat region was the most highly conserved fragment of the PrP across species, suggesting that it might play a vital role in PrPc function (Wopfner et al. 1999). The CDS length variation of PRNP among species of Bovidae was mainly due to 24-bp insertions or deletions in the octapeptide repeat. PRNP exon 3 possesses 4–7 octapeptide repeats in cattle (Seabury, Womack, et al. 2004). The length of the coding region in Caprinae is 771 bp (5 repeats), encoding 256 amino acids, whereas that in Bovinae has 4 variant types, mainly 795 bp (6 repeats), encoding 264 amino acids. Though there are length differences in Bovidae, the similarity of sequences is very high (96.1%, Wu et al. 2006). The length variation of 24-bp occurs in Bovidae, Cercopithecidae, and Equidae, but the types are different: the first 2 families had variation in the repeat region, whereas the last one had an elongation after the stop codon mutation. In contrast to octapeptide repeats in mammalian species, the avian PrP has hexapeptide repeats. The length difference in G. gallus and T. guttata is due to 18-bp insertion in hexapeptide repeats. There are 3-bp (CTC) deletions encoding leucine in C. bactrianus, P. muticus, and C. coturnix. Based on the discussion above, the differences of CDS length in PRNP have mainly resulted from deletions or insertions in repeat region or a 3-bp region, within species or family.
Stop Codon Variation among Different Families
Most of the families use the stop codon TGA, with some that use TAG or TAA. Equidae, including Equus caballu, E. asinus, Equus burchellii, Equus przewalskii, Equus zebra, and Equus kiang; Cyprinidae including D. rerio; and Macropodidae including Macropus eugenii use the stop codon TAA, except for a sequence of E. asinus (EF127815
[GenBank]
), where TAA is mutated to TTC resulting in an elongation of 24 bp, using TGA as stop codon. Bovidae, Cervidae, Camelidae, and Estrildidae use TAG as stop codon except for a sequence of C. hircus (AF117315
[GenBank]
), which was from cell line CCL 73. Results indicate that the stop codon of PRNP exhibits bias in usage, with TGA and TAG mainly used. TAG is used in 39 species belonging to Bovidae, Cervidae, Camelidae, and Estrildidae; TAA is used in 8 species belonging to Equidae, Cyprinidae, and Macropodidae; and TGA is used in 36 species belonging to additional families. Li et al. (2007) also found stop codon variation of the MSHR gene within and among different families. They also indicated that most families use the stop codon TGA and only a minority of families used TAG or TAA. Sun et al. (2005) found that UAA is overrepresented in lower eukaryotes, UGA is overrepresented in the higher eukaryotes; and UAG is the least used stop codon in all eukaryotes. But, TGA and TAG are mainly used as the stop codon of PRNP gene.
Sun et al. (2005) indicated that G + C content at the third codon positions (GC3) might contribute to stop codon usage bias in different eukaryotes. In the current study, GC3 with different stop codon usage is 0.615, 0.608, and 0.534 for TAA, TGA, and TAG, respectively. In mammalian species, the GC3 content is 0.608 for TAA, 0.596 for TGA, and 0.531 for TAG. In aves, TGA and TAG are used as stop codons, with GC3 content of 0.651 and 0.779, respectively. Only TGA is used in Xenopus, with GC3 content 0.497, and TAA is used in Danio, with GC3 content 0.648. So GC3 content might be related with stop codon usage bias in different species or families.
Phylogenetic Relationship of Families and Species
The phylogenic tree of all families reconstructed by UPGMA based on dN (see Table 2 Supplementary Material online) is basically consistent with the taxonomy of NCBI except for Felidae, which is first clustered with Moschidae rather than Mustelidae and Canidae (Figure 1). Generally, Felidae, Canidae, and Mustelidae belong to Laurasiatheria, and Moschidae belongs to Cetartiodactyla. The similarity between Felis catus (AF003087
[GenBank]
) and Moschus chrysogaster (AY723286
[GenBank]
) is 94%, whereas it is 85% between F. catus (AF003087
[GenBank]
) and Canis familiaris (EF139170
[GenBank]
) and 87% between F. catus (AF003087
[GenBank]
) and 3 species (EF508270
[GenBank]
, U08952
[GenBank]
, and S46825
[GenBank]
) of Mustela. The PRNP gene tree of 83 species (Figure 2) is basically consistent with the species tree except for F. catus, which is first clustered with A. lervia and B. taxicolor. The similarity is 98% between F. catus (AF003087
[GenBank]
) and A. lervia (EF165080
[GenBank]
) or B. taxicolor (AB060290
[GenBank]
). These findings might explain the fact that Feline spongiform encephalopathy has been found in cats (Aguzzi et al. 2004), but no natural prion disease has been documented in dogs.
|
|
Genetic Diversity within and among Species and Families
A total of 266 haplotypes were identified from 937 sequences of different families, which were aligned by BIOEDIT spanning 996 bp. The result of DNASP analysis indicated that the selected region (1–996) of 266 haplotypes from different species has 383 sites, excluding sites with gaps. There are 39 invariant (monomorphic) sites and 344 variable (polymorphic) sites that include 10 singleton variables and 334 parsimony informative. All the polymorphic sites are located from 439 to 929 bp, which is a region with higher point mutations. All the singleton variable sites have 2 variants. There are 141 parsimony-informative sites with 2 variants, 124 sites with 3 variants, and 69 sites with 4 variants. The nucleotide diversity and average number of nucleotide differences for all haplotypes are 0.105 and 40.2, respectively. The number of synonymous substitutions per synonymous site (dS) and nonsynonymous substitutions per nonsynonymous site (dN) for all haplotypes are 0.205 ± 0.027 and 0.108 ± 0.010, respectively.
The genetic diversity in sheep is higher than in cattle. Ovis aries has the largest haplotypes (59), number of total mutations (41), and nonsynonymous mutations (26). Bos taurus has the smallest average number of nucleotide differences (0.811), smallest nucleotide diversity (0.0011), and a smaller nonsynonymous nucleotide diversity (0.0002). In sheep, 59 haplotypes and high variability is found using 478 PRNP CDS sequences, whereas a small average number of nucleotide difference is found from 180 sequences in cattle. The PNRP species difference of genetic diversity may have resulted from natural selection. Balancing selection in sheep (Slate 2005) and strong purifying selection for PRNP CDS in cattle (Seabury, Honeycutt, et al. 2004) have been reported earlier. Concerning sheep scrapie, 3 PRNP codons (136, 154, and 171) are largely responsible for determining scrapie susceptibility (Goldmann et al. 1990; Hunter et al. 1997). Besides a relatively resistant (ARR) and 2 relatively susceptible (VRQ and ARQ) haplotypes, whether other specific halpotypes found in this study are related to scrapie resistance or susceptibility should be further investigated.
Species barriers to the TSE agent are strongly influenced by the PrP amino acid sequence of both the donor and the recipient animals (Vorberg et al. 2003). Many residues and regions in the prion protein have been implicated in function, pathogenicity, and species barrier. The evolutionary persistence of the globular domain of the protein across vertebrate classes suggests that it has an important and conserved function, perhaps promoting protein–protein interactions (van Rheede et al. 2003). In the rabbit, multiple amino acid residues identified could inhibit the conversion of PrP-sen to its abnormal isoform within the central region and the C-terminal portion of the PrP molecule (Vorberg et al. 2003). However, a phylogenetic tree based on multiple sequence alignment agrees with the species tree. This agreement suggests that no dramatic sequence changes have occurred to avoid cross-species TSE infectivity. The similarity of PrP sequence between cattle and goat or sheep is more than 99%. Bovine and sheep PrP have similar evolutionary distance with human PrP sequence. The bovine spongiform encephalopathy agent, however, is able to cross the so-called "species barrier" and infect humans, but theTSE disease in sheep, scrapie, has been endemic in United Kingdom for more than 200 years (Gravenor et al. 2000), yet has never been transmitted to humans. Predicting species barriers for transmission based on genetic variations only, therefore, is not possible for PRNP. The functional residues and specific tertiary structure of PrP should be more fully studied to explain TSE species barrier.
| Supplementary Materials |
|---|
|
|
|---|
Supplementary material can be found at http://www.jhered.oxfordjournals.org/.
| Funding |
|---|
|
|
|---|
National key scientific and technological project (2006BAD0410-06).
| Acknowledgments |
|---|
We are very grateful to Dr Navneet Sharma from University of Calgary and Mr Jiuquan Han in Agricultural University of Hebei for the English correction of the manuscript. We also thank Dr Lamont from Iowa State University for critical reading of the manuscript.
| Footnotes |
|---|
Corresponding Editor: Susan Lamont
Received September 3, 2007
Accepted July 31, 2008
| References |
|---|
|
|
|---|
-
Acutis PL, Bossers A, Priem J, Riina MV, Peletto S, Mazza M, Casalone C, Forloni G, Ru G, Caramelli M. Identification of prion protein gene polymorphisms in goats from Italian scrapie outbreaks. J Gen Virol (2006) 87:1029–1033.
Aguzzi A, Heikenwalder M, Miele G. Progress and problems in the biology, diagnostics, and therapeutics of prion diseases. J Clin Invest (2004) 114:153–160.[CrossRef][Web of Science][Medline]
Aguzzi A, Sigurdson CJ. Antiprion immunotherapy: to suppress or to stimulate? Nat Rev Immunol (2004) 4:725–736.[CrossRef][Web of Science][Medline]
Billinis C, Panagiotidis CH, Psychas V, Argyroudis S, Nicolaou A, Leontides S, Papadopoulos O, Sklaviadis T. Prion protein gene polymorphisms in natural goat scrapie. J Gen Virol (2002) 83:713–721.
Collinge J, Beck J, Campbell T, Estibeiro K, Will RG. Prion protein gene analysis in new variant cases of Creutzfeldt-Jakob disease. Lancet (1996) 348:56.[Web of Science][Medline]
Cotto E, Andre M, Forgue J, Fleury HJ, Babin PJ. Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio). FEBS J (2005) 272:500–513.[CrossRef][Medline]
Goldmann W, Hunter N, Foster JD, Salbaum JM, Beyreuther K, Hope J. Two alleles of a neural protein gene linked to scrapie in sheep. Proc Natl Acad Sci USA (1990) 87:2476–2480.
Goldmann W, Hunter N, Somerville R, Hope J. Prion phylogeny revisited. Nature (1996) 382:32–33.[Medline]
Goldmann W, Martin T, Foster J, Hughes S, Smith G, Hughes K, Dawson M, Hunter N. Novel polymorphisms in the caprine PrP gene: a codon 142 mutation associated with scrapie incubation period. J Gen Virol (1996) 77:2885–2891.
Gombojav A, Ishiguro N, Horiuchi M, Serjmyadag D, Byambaa B, Shinagawa M. Amino acid polymorphisms of PrP gene in Mongolian sheep. J Vet Med Sci (2003) 65:75–81.[CrossRef][Web of Science][Medline]
Gravenor MB, Cox DR, Hoinville LJ, Hoek A, McLean AR. Scrapie in Britain during the BSE years. Nature (2000) 406:584–585.[CrossRef][Web of Science][Medline]
Hunter N, Goldmann W, Foster JD, Cairns D, Smith G. Natural scrapie and PrP genotype: case-control studies in British sheep. Vet Rec (1997) 141:137–140.
Huson HJ, Happ GM. Polymorphisms of the prion protein gene (PRNP) in Alaskan moose (Alces alces gigas). Anim Genet (2006) 37:425–426.[CrossRef][Web of Science][Medline]
Jeong HJ, Lee JB, Park SY, Song CS, Kim BS, Rho JR, Yoo MH, Jeong BH, Kim YS, Choi IS. Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus). J Vet Sci (2007) 8:299–301.[Web of Science][Medline]
Johnson C, Johnson J, Vanderloo JP, Keane D, Aiken JM, McKenzie D. Prion protein polymorphisms in white-tailed deer influence susceptibility to chronic wasting disease. J Gen Virol (2006) 87:2109–2114.
Khlebodarova TM, Malchenko SN, Pack SD, Sokolova OV, Alabiev BY, Belousov ES, Peremislov VV, Nayakshin AM, Brusgaard K, Serov OL. Chromosomal and regional localization of the loci for IGKC, IGGC, ALDB, HOXB, G, and PRNP in the American mink (Mustela vison): comparisons with human and mouse. Mamm Genome (1995) 6:705–709.[CrossRef][Web of Science][Medline]
Kurosaki Y, Ishiguro N, Horiuchi M, Shinagawa M. Polymorphisms of caprine PrP gene detected in Japan. J Vet Med Sci (2005) 67:321–323.[CrossRef][Web of Science][Medline]
Lee IY, Westaway D, Smit AF, Wang K, Seto J, Chen L, Acharya C, Ankener M, Baskin D, Cooper C, et al. Complete genomic sequence and analysis of the prion protein gene region from three mammalian species. Genome Res (1998) 8:1022–1037.
Li XL, Zheng GR, Zhou RY. Evolution and differentiation of MSHR gene in different species. J Hered (2007) 3:165–168.
Meng LP, Zhao DM, Liu HX, Yang JM, Ning ZY, Wu CD, Han CX. Polymorphisms of the prion protein gene (PRNP) in Chinese domestic sika deer (Cervus nippon hortulorum). Anim Genet (2005) 36:266–267.[Web of Science][Medline]
O'Rourke KI, Besser TE, Miller MW, Cline TF, Spraker TR, Jenny AL, Wild MA, Zebarth GL, Williams ES. PrP genotypes of caive and free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) with chronic wasting disease. J Gen Virol (1999) 80:2765–2769.
O'Rourke KI, Spraker TR, Hamburg LK, Besser TE, Brayton KA, Knowles DP. Polymorphisms in the prion precursor functional gene but not the pseudogene are associated with susceptibility to chronic wasting disease in white-tailed deer. J Gen Virol (2004) 85:1339–1346.
Premzl M, Gamulin V. Comparative genomic analysis of prion genes. BMC Genomics (2007) 8:1–14.[CrossRef][Medline]
Premzl M, Gready JE, Jermiin LS, Simonic T, Marshall Graves J. Evolution of vertebrate genes related to prion and Shadoo proteins—clues from comparative genomic analysis. Mol Biol Evol (2004) 21:2210–2231.
Prusiner SB, Scott MR. Genetics of prions. Annu Rev Genet (1997) 31:139–175.[CrossRef][Web of Science][Medline]
Seabury CM, Honeycutt RL, Rooney AP, Halbert ND, Derr JN. Prion protein gene (PRNP) variants and evidence for strong purifying selection in functionally important regions of bovine exon 3. Proc Natl Acad Sci USA (2004) 101:15142–15147.
Seabury CH, Womack EJ, Piedrahita J, Derr NJ. Comparative PRNP genotyping of U.S. cattle sires for potential association with BSE. Mamm Genome (2004) 15:828–833.[CrossRef][Web of Science][Medline]
Slate J. Molecular evolution of the sheep prion protein gene. Proc Biol Sci (2005) 272:2371–2377.
Sun J, Chen M, Xu J, Luo J. Relationships among stop codon usage bias, its context, isochores, and gene expression level in various eukaryotes. J Mol Evol (2005) 61:437–444.[CrossRef][Web of Science][Medline]
Tajima F. Evolutionary relationship of DNA sequences in finite populations. Genetics (1983) 105:437–460.
Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol (2007) 24:1596–1599.
Vaccari G, Di Bari MA, Morelli L, Nonno R, Chiappini B, Antonucci G, Marcon S, Esposito E, Fazzi P, Palazzini N, et al. Identification of an allelic variant of the goat PrP gene associated with resistance to scrapie. J Gen Virol (2006) 87:1395–1402.
van Rheede T, Smolenaars MM, Madsen O, de Jong WW. Molecular evolution of the mammalian prion protein. Mol Biol Evol (2003) 20:111–121.
Vorberg I, Groschup MH, Pfaff E, Priola SA. Multiple amino acid residues within the rabbit prion protein inhibit formation of its abnormal isoform. J Virol (2003) 77:2003–2009.
Westaway D, Cooper C, Turner S, Costa M, Carlson GA, Prusiner SB. Structure and polymorphism of the mouse prion protein gene. Proc Natl Acad Sci USA (1994) 91:6418–6422.
Wopfner F, Weidenhofer G, Schneider R, von Brunn A, Gilch S, Schwarz TF, Werner T, Schatzl HM. Analysis of 27 mammalian and 9 avian PrPs reveals high conservation of flexible regions of the prion protein. J Mol Biol (1999) 289:1163–1178.[CrossRef][Web of Science][Medline]
Wu R, Chen H, Xie Q. Analysis on variability and phylogenetic relationship of prion protein genes. Sci Agric Sin (2006) 39:1253–1263.
Zhang J, Rosenberg HF, Nei M. Positive Darwinian selection after gene duplication in primate ribonuclease genes. Proc Natl Acad Sci USA (1998) 95:3708–3713.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

